EMAIL THIS PAGE TO A FRIEND

GP9

glycoprotein IX (platelet)

61 Gene Product Result for
Synonyms: CD42a GPIX
UniProtKB ID: P14770, Q14445, Q8N1D1, Q92525
Gene ID:
Human(2815) Summary: This gene encodes a small membrane glycoprotein found on the surface of human platelets. It forms a 1-to-1 noncovalent complex with glycoprotein Ib, a platelet surface membrane glycoprotein complex that functions as a receptor for von Willebrand factor. The complete receptor complex includes noncovalent association of the alpha and beta subunits with the protein encoded by this gene and platelet glycoprotein V. Defects in this gene are a cause of Bernard-Soulier syndrome, also known as giant platelet disease. These patients have unusually large platelets and have a clinical bleeding tendency. [provided by RefSeq, Oct 2008]
Mouse(54368) glycoprotein 9 (platelet)
Rat(502858) glycoprotein IX (platelet)
sheep(101112264) glycoprotein IX (platelet)
domestic guinea pig(100715089) glycoprotein IX (platelet)
naked mole-rat(101697287) glycoprotein IX (platelet)
chicken(415971) glycoprotein IX (platelet)
cow(617668) glycoprotein IX (platelet)
domestic cat(101084179) glycoprotein IX (platelet)
dog(609630) glycoprotein IX (platelet)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000174 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000174 Rosetta Predictions human pricing
NM_001031825 Rosetta Predictions rat pricing
NM_018762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121771 predicted 446
2 SASI_Hs01_00121772 predicted 421
3 SASI_Hs01_00121773 predicted 348
4 SASI_Hs01_00121774 predicted 413
5 SASI_Hs01_00121776 predicted 346
6 SASI_Hs01_00121777 predicted 260
7 SASI_Hs01_00121778 predicted 348
8 SASI_Hs01_00121779 predicted 560
9 SASI_Hs02_00302010 predicted 552
10 SASI_Hs02_00302011 predicted 550
11 SASI_Hs01_00121775 predicted 458
12 SASI_Hs01_00121780 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036753 predicted 232
2 SASI_Rn01_00036754 predicted 349
3 SASI_Rn01_00036755 predicted 342
4 SASI_Rn01_00036756 predicted 255
5 SASI_Rn01_00036757 predicted 209
6 SASI_Rn01_00036758 predicted 258
7 SASI_Rn01_00036759 predicted 235
8 SASI_Rn01_00036760 predicted 292
9 SASI_Rn01_00036761 predicted 305
10 SASI_Rn01_00036762 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324070 predicted 313
2 SASI_Mm01_00075980 predicted 542
3 SASI_Mm01_00075981 predicted 579
4 SASI_Mm01_00075982 predicted 530
5 SASI_Mm01_00075983 predicted 364
6 SASI_Mm01_00075984 predicted 219
7 SASI_Mm01_00075985 predicted 572
8 SASI_Mm01_00075986 predicted 524
9 SASI_Mm01_00075987 predicted 356
10 SASI_Mm01_00075988 predicted 255
11 SASI_Mm01_00075989 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018762
GP9 MISSION shRNA Bacterial Glycerol Stock
glycoprotein IX (platelet)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-549s1c1
Sequence:CCGGGCTGGTCTATTGAACACATTTCTCGAGAAATGTGTTCAATAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-547s1c1
Sequence:CCGGTGGCTGGTCTATTGAACACATCTCGAGATGTGTTCAATAGACCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-226s1c1
Sequence:CCGGTGGCCAACAATAGCCTGCGTTCTCGAGAACGCAGGCTATTGTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-423s1c1
Sequence:CCGGCTGGGCCAGCTGACAGGTTATCTCGAGATAACCTGTCAGCTGGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-372s1c1
Sequence:CCGGGCCCTAATGCATGTGTACTGTCTCGAGACAGTACACATGCATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018762
GP9 MISSION shRNA shRNA Plasmid DNA
glycoprotein IX (platelet)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-549s1c1
Sequence:CCGGGCTGGTCTATTGAACACATTTCTCGAGAAATGTGTTCAATAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-547s1c1
Sequence:CCGGTGGCTGGTCTATTGAACACATCTCGAGATGTGTTCAATAGACCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-226s1c1
Sequence:CCGGTGGCCAACAATAGCCTGCGTTCTCGAGAACGCAGGCTATTGTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-423s1c1
Sequence:CCGGCTGGGCCAGCTGACAGGTTATCTCGAGATAACCTGTCAGCTGGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-372s1c1
Sequence:CCGGGCCCTAATGCATGTGTACTGTCTCGAGACAGTACACATGCATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018762
GP9 MISSION shRNA Lentiviral Transduction Particles
glycoprotein IX (platelet)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-549s1c1
Sequence:CCGGGCTGGTCTATTGAACACATTTCTCGAGAAATGTGTTCAATAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-547s1c1
Sequence:CCGGTGGCTGGTCTATTGAACACATCTCGAGATGTGTTCAATAGACCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-226s1c1
Sequence:CCGGTGGCCAACAATAGCCTGCGTTCTCGAGAACGCAGGCTATTGTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-423s1c1
Sequence:CCGGCTGGGCCAGCTGACAGGTTATCTCGAGATAACCTGTCAGCTGGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018762.1-372s1c1
Sequence:CCGGGCCCTAATGCATGTGTACTGTCTCGAGACAGTACACATGCATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000174
GP9 MISSION shRNA Bacterial Glycerol Stock
glycoprotein IX (platelet)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-456s1c1
Sequence:CCGGGACCCTCGATGTGACGCAGAACTCGAGTTCTGCGTCACATCGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-391s1c1
Sequence:CCGGCTGCTGGCCAACAACAGCCTTCTCGAGAAGGCTGTTGTTGGCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-256s1c1
Sequence:CCGGGCCACAGCAGAGGCCACCAAGCTCGAGCTTGGTGGCCTCTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-497s1c1
Sequence:CCGGGCCTCACCTATCTGCGCCTCTCTCGAGAGAGGCGCAGATAGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-705s1c1
Sequence:CCGGCCTGGCTCTTCTGGCTGGCCTCTCGAGAGGCCAGCCAGAAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000174
GP9 MISSION shRNA shRNA Plasmid DNA
glycoprotein IX (platelet)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-456s1c1
Sequence:CCGGGACCCTCGATGTGACGCAGAACTCGAGTTCTGCGTCACATCGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-391s1c1
Sequence:CCGGCTGCTGGCCAACAACAGCCTTCTCGAGAAGGCTGTTGTTGGCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-256s1c1
Sequence:CCGGGCCACAGCAGAGGCCACCAAGCTCGAGCTTGGTGGCCTCTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-497s1c1
Sequence:CCGGGCCTCACCTATCTGCGCCTCTCTCGAGAGAGGCGCAGATAGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-705s1c1
Sequence:CCGGCCTGGCTCTTCTGGCTGGCCTCTCGAGAGGCCAGCCAGAAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000174
GP9 MISSION shRNA Lentiviral Transduction Particles
glycoprotein IX (platelet)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-456s1c1
Sequence:CCGGGACCCTCGATGTGACGCAGAACTCGAGTTCTGCGTCACATCGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-391s1c1
Sequence:CCGGCTGCTGGCCAACAACAGCCTTCTCGAGAAGGCTGTTGTTGGCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-256s1c1
Sequence:CCGGGCCACAGCAGAGGCCACCAAGCTCGAGCTTGGTGGCCTCTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-497s1c1
Sequence:CCGGGCCTCACCTATCTGCGCCTCTCTCGAGAGAGGCGCAGATAGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000174.1-705s1c1
Sequence:CCGGCCTGGCTCTTCTGGCTGGCCTCTCGAGAGGCCAGCCAGAAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks