EMAIL THIS PAGE TO A FRIEND

GPA33

glycoprotein A33 (transmembrane)

56 Gene Product Result for
Synonyms: A33
UniProtKB ID: Q99795, Q5VZP6
Gene ID:
Human(10223) Summary: The glycoprotein encoded by this gene is a cell surface antigen that is expressed in greater than 95% of human colon cancers. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. The sequence of the extracellular region contains 2 domains characteristic of the CD2 subgroup of the immunoglobulin (Ig) superfamily. [provided by RefSeq, Jul 2008]
Mouse(59290) glycoprotein A33 (transmembrane)
Rat(360873) glycoprotein A33 (transmembrane)
chicken(418445) glycoprotein A33 (transmembrane)
cow(518646) glycoprotein A33 (transmembrane)
domestic cat(101101533) glycoprotein A33 (transmembrane)
dog(611598) glycoprotein A33 (transmembrane)
domestic guinea pig(100735367) glycoprotein A33 (transmembrane)
naked mole-rat(101714265) glycoprotein A33 (transmembrane)
sheep(101110729) glycoprotein A33 (transmembrane)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005814 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005814 Rosetta Predictions human pricing
XM_001075707 Rosetta Predictions rat pricing
XM_341149 Rosetta Predictions rat pricing
NM_021610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119895 predicted 782
2 SASI_Hs01_00119896 predicted 688
3 SASI_Hs01_00119897 predicted 1019
4 SASI_Hs01_00119898 predicted 947
5 SASI_Hs01_00119899 predicted 685
6 SASI_Hs01_00119901 predicted 377
7 SASI_Hs01_00119902 predicted 490
8 SASI_Hs02_00340340 predicted 786
9 SASI_Hs01_00119903 predicted 490
10 SASI_Hs01_00119904 predicted 670
11 SASI_Hs01_00119900 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350771 predicted 277
2 SASI_Rn02_00350772 predicted 507
3 SASI_Rn02_00350773 predicted 411
4 SASI_Rn02_00350774 predicted 298
5 SASI_Rn02_00350775 predicted 365
6 SASI_Rn02_00350776 predicted 356
7 SASI_Rn02_00350777 predicted 201
8 SASI_Rn02_00350778 predicted 727
9 SASI_Rn02_00350779 predicted 674
10 SASI_Rn02_00350780 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392483 predicted 815
2 SASI_Rn02_00392484 predicted 798
3 SASI_Rn02_00392485 predicted 726
4 SASI_Rn02_00392486 predicted 729
5 SASI_Rn02_00392487 predicted 724
6 SASI_Rn02_00392488 predicted 724
7 SASI_Rn02_00392489 predicted 670
8 SASI_Rn02_00392490 predicted 796
9 SASI_Rn02_00392491 predicted 688
10 SASI_Rn02_00392492 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043401 predicted 257
2 SASI_Mm01_00043402 predicted 937
3 SASI_Mm01_00043403 predicted 827
4 SASI_Mm01_00043404 predicted 294
5 SASI_Mm01_00043405 predicted 368
6 SASI_Mm01_00043406 predicted 356
7 SASI_Mm01_00043407 predicted 789
8 SASI_Mm01_00043408 predicted 1343
9 SASI_Mm01_00043409 predicted 987
10 SASI_Mm01_00043410 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005814
GPA33 MISSION shRNA Bacterial Glycerol Stock
glycoprotein A33 (transmembrane)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-606s1c1
Sequence:CCGGCGCGTCAGCATATCCAACAATCTCGAGATTGTTGGATATGCTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-794s1c1
Sequence:CCGGAGAGACCATAATTGGGAACAACTCGAGTTGTTCCCAATTATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-502s1c1
Sequence:CCGGAGGGACTTATTCAATGGGATACTCGAGTATCCCATTGAATAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-1236s1c1
Sequence:CCGGGAGGATGACTACAGGCAAGAACTCGAGTTCTTGCCTGTAGTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-950s1c1
Sequence:CCGGCACAGACACATCGGGTTACTACTCGAGTAGTAACCCGATGTGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005814.1-580s21c1
Sequence:CCGGACATCCATGGTGAGCTTTATACTCGAGTATAAAGCTCACCATGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005814.1-1766s21c1
Sequence:CCGGATGAAAGAATAAGTGAGTATGCTCGAGCATACTCACTTATTCTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005814.1-871s21c1
Sequence:CCGGAGAGGTACAACATCCTGAATCCTCGAGGATTCAGGATGTTGTACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005814.1-538s21c1
Sequence:CCGGATACGGAAAGGGTGGTCATCTCTCGAGAGATGACCACCCTTTCCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005814
GPA33 MISSION shRNA shRNA Plasmid DNA
glycoprotein A33 (transmembrane)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-606s1c1
Sequence:CCGGCGCGTCAGCATATCCAACAATCTCGAGATTGTTGGATATGCTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-794s1c1
Sequence:CCGGAGAGACCATAATTGGGAACAACTCGAGTTGTTCCCAATTATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-502s1c1
Sequence:CCGGAGGGACTTATTCAATGGGATACTCGAGTATCCCATTGAATAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-1236s1c1
Sequence:CCGGGAGGATGACTACAGGCAAGAACTCGAGTTCTTGCCTGTAGTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-950s1c1
Sequence:CCGGCACAGACACATCGGGTTACTACTCGAGTAGTAACCCGATGTGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005814.1-580s21c1
Sequence:CCGGACATCCATGGTGAGCTTTATACTCGAGTATAAAGCTCACCATGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005814.1-1766s21c1
Sequence:CCGGATGAAAGAATAAGTGAGTATGCTCGAGCATACTCACTTATTCTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005814.1-871s21c1
Sequence:CCGGAGAGGTACAACATCCTGAATCCTCGAGGATTCAGGATGTTGTACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005814.1-538s21c1
Sequence:CCGGATACGGAAAGGGTGGTCATCTCTCGAGAGATGACCACCCTTTCCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005814
GPA33 MISSION shRNA Lentiviral Transduction Particles
glycoprotein A33 (transmembrane)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-606s1c1
Sequence:CCGGCGCGTCAGCATATCCAACAATCTCGAGATTGTTGGATATGCTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-794s1c1
Sequence:CCGGAGAGACCATAATTGGGAACAACTCGAGTTGTTCCCAATTATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-502s1c1
Sequence:CCGGAGGGACTTATTCAATGGGATACTCGAGTATCCCATTGAATAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-1236s1c1
Sequence:CCGGGAGGATGACTACAGGCAAGAACTCGAGTTCTTGCCTGTAGTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005814.1-950s1c1
Sequence:CCGGCACAGACACATCGGGTTACTACTCGAGTAGTAACCCGATGTGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005814.1-580s21c1
Sequence:CCGGACATCCATGGTGAGCTTTATACTCGAGTATAAAGCTCACCATGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005814.1-1766s21c1
Sequence:CCGGATGAAAGAATAAGTGAGTATGCTCGAGCATACTCACTTATTCTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005814.1-871s21c1
Sequence:CCGGAGAGGTACAACATCCTGAATCCTCGAGGATTCAGGATGTTGTACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005814.1-538s21c1
Sequence:CCGGATACGGAAAGGGTGGTCATCTCTCGAGAGATGACCACCCTTTCCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021610
GPA33 MISSION shRNA Bacterial Glycerol Stock
glycoprotein A33 (transmembrane)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-847s1c1
Sequence:CCGGCTCATCATCATCGGTGTCATTCTCGAGAATGACACCGATGATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-684s1c1
Sequence:CCGGGCCATTGTTGCTGAAGAACATCTCGAGATGTTCTTCAGCAACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-555s1c1
Sequence:CCGGGATGGTGATCGGGAACAACATCTCGAGATGTTGTTCCCGATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-231s1c1
Sequence:CCGGCACCTACAACACCTATGTTTCCTCGAGGAAACATAGGTGTTGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-419s21c1
Sequence:CCGGAGCTGACCATGGACGACAATGCTCGAGCATTGTCGTCCATGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021610.1-1480s21c1
Sequence:CCGGATGGGCCTGCACGCAATATTTCTCGAGAAATATTGCGTGCAGGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-797s21c1
Sequence:CCGGCCATGAACATTGCGCTGTATGCTCGAGCATACAGCGCAATGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-231s21c1
Sequence:CCGGCACCTACAACACCTATGTTTCCTCGAGGAAACATAGGTGTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-337s21c1
Sequence:CCGGTACATCTATGGGAACCGTTATCTCGAGATAACGGTTCCCATAGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021610
GPA33 MISSION shRNA shRNA Plasmid DNA
glycoprotein A33 (transmembrane)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-847s1c1
Sequence:CCGGCTCATCATCATCGGTGTCATTCTCGAGAATGACACCGATGATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-684s1c1
Sequence:CCGGGCCATTGTTGCTGAAGAACATCTCGAGATGTTCTTCAGCAACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-555s1c1
Sequence:CCGGGATGGTGATCGGGAACAACATCTCGAGATGTTGTTCCCGATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-231s1c1
Sequence:CCGGCACCTACAACACCTATGTTTCCTCGAGGAAACATAGGTGTTGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-419s21c1
Sequence:CCGGAGCTGACCATGGACGACAATGCTCGAGCATTGTCGTCCATGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021610.1-1480s21c1
Sequence:CCGGATGGGCCTGCACGCAATATTTCTCGAGAAATATTGCGTGCAGGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-797s21c1
Sequence:CCGGCCATGAACATTGCGCTGTATGCTCGAGCATACAGCGCAATGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-231s21c1
Sequence:CCGGCACCTACAACACCTATGTTTCCTCGAGGAAACATAGGTGTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-337s21c1
Sequence:CCGGTACATCTATGGGAACCGTTATCTCGAGATAACGGTTCCCATAGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021610
GPA33 MISSION shRNA Lentiviral Transduction Particles
glycoprotein A33 (transmembrane)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-847s1c1
Sequence:CCGGCTCATCATCATCGGTGTCATTCTCGAGAATGACACCGATGATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-684s1c1
Sequence:CCGGGCCATTGTTGCTGAAGAACATCTCGAGATGTTCTTCAGCAACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-555s1c1
Sequence:CCGGGATGGTGATCGGGAACAACATCTCGAGATGTTGTTCCCGATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021610.1-231s1c1
Sequence:CCGGCACCTACAACACCTATGTTTCCTCGAGGAAACATAGGTGTTGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-419s21c1
Sequence:CCGGAGCTGACCATGGACGACAATGCTCGAGCATTGTCGTCCATGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021610.1-1480s21c1
Sequence:CCGGATGGGCCTGCACGCAATATTTCTCGAGAAATATTGCGTGCAGGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-797s21c1
Sequence:CCGGCCATGAACATTGCGCTGTATGCTCGAGCATACAGCGCAATGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-231s21c1
Sequence:CCGGCACCTACAACACCTATGTTTCCTCGAGGAAACATAGGTGTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021610.1-337s21c1
Sequence:CCGGTACATCTATGGGAACCGTTATCTCGAGATAACGGTTCCCATAGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks