EMAIL THIS PAGE TO A FRIEND

GPAA1

glycosylphosphatidylinositol anchor attachment 1

48 Gene Product Result for
Synonyms: GAA1 hGAA1
UniProtKB ID: O43292, Q9NSS0, Q9UQ31
Gene ID:
Human(8733) Summary: Posttranslational glycosylphosphatidylinositol (GPI) anchor attachment serves as a general mechanism for linking proteins to the cell surface membrane. The protein encoded by this gene presumably functions in GPI anchoring at the GPI transfer step. The mRNA transcript is ubiquitously expressed in both fetal and adult tissues. The anchor attachment protein 1 contains an N-terminal signal sequence, 1 cAMP- and cGMP-dependent protein kinase phosphorylation site, 1 leucine zipper pattern, 2 potential N-glycosylation sites, and 8 putative transmembrane domains. [provided by RefSeq, Jul 2008]
Mouse(14731) GPI anchor attachment protein 1
Rat(300046) glycosylphosphatidylinositol anchor attachment 1
sheep(101112655) glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)
Domestic Rabbit(100341924) glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)
domestic guinea pig(100713167) glycosylphosphatidylinositol anchor attachment 1
naked mole-rat(101701181) glycosylphosphatidylinositol anchor attachment 1
dog(475120) glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)
domestic cat(101093994) glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)
cow(513395) glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303092 ANTI-GPAA1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
AV46363 Anti-GPAA1 antibody produced in rabbit affinity isolated antibody mouse, bovine, rat, horse, canine, rabbit, guinea pig, human
immunohistochemistry, western blot pricing
SAB2700508 Anti-GPAA1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003801 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003801 Rosetta Predictions human pricing
NM_001004240 Rosetta Predictions rat pricing
NM_010331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202648 predicted 1426
2 SASI_Hs01_00202650 predicted 243
3 SASI_Hs01_00202651 predicted 973
4 SASI_Hs01_00202652 predicted 402
5 SASI_Hs02_00336325 predicted 643
6 SASI_Hs01_00202653 predicted 484
7 SASI_Hs01_00202654 predicted 1496
8 SASI_Hs02_00336326 predicted 436
9 SASI_Hs02_00336327 predicted 679
10 SASI_Hs02_00336328 predicted 244
11 SASI_Hs01_00202647 predicted 1056
12 SASI_Hs01_00202649 predicted 649
13 SASI_Hs01_00202655 predicted 1074
14 SASI_Hs01_00202656 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198249 predicted 217
2 SASI_Rn01_00074781 predicted 445
3 SASI_Rn01_00074782 predicted 1463
4 SASI_Rn01_00074783 predicted 1737
5 SASI_Rn01_00074784 predicted 1035
6 SASI_Rn01_00074785 predicted 429
7 SASI_Rn01_00074786 predicted 589
8 SASI_Rn01_00074787 predicted 1047
9 SASI_Rn01_00074788 predicted 626
10 SASI_Rn01_00074789 predicted 300
11 SASI_Rn01_00074790 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109770 predicted 230
2 SASI_Mm01_00109772 predicted 638
3 SASI_Mm01_00109773 predicted 1193
4 SASI_Mm01_00109774 predicted 1054
5 SASI_Mm01_00109775 predicted 450
6 SASI_Mm01_00109776 predicted 466
7 SASI_Mm01_00109777 predicted 1488
8 SASI_Mm01_00109778 predicted 1718
9 SASI_Mm01_00109779 predicted 214
10 SASI_Mm02_00318338 predicted 693
11 SASI_Mm01_00109771 predicted 1629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010331
VALIDATED
GPAA1 MISSION shRNA Bacterial Glycerol Stock
glycosylphosphatidylinositol anchor attachment 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-1155s21c1
Sequence:CCGGGCACCAGTCATTCTTCTTCTACTCGAGTAGAAGAAGAATGACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-1492s21c1
Sequence:CCGGTTGACGCTGCTCGCGATTTATCTCGAGATAAATCGCGAGCAGCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-1046s21c1
Sequence:CCGGTAACCCTACGCGGCATCAATACTCGAGTATTGATGCCGCGTAGGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-444s21c1
Sequence:CCGGTGAGACCCACGAGCGCTATATCTCGAGATATAGCGCTCGTGGGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-684s21c1
Sequence:CCGGCGAAGCCTACCATGACATTAACTCGAGTTAATGTCATGGTAGGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010331.2-1071s1c1
Sequence:CCGGCCGCCAATACAAGTATGATTTCTCGAGAAATCATACTTGTATTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010331.2-684s1c1
Sequence:CCGGCGAAGCCTACCATGACATTAACTCGAGTTAATGTCATGGTAGGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010331.2-1861s1c1
Sequence:CCGGGTGCTGGAACACTACACCTATCTCGAGATAGGTGTAGTGTTCCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010331.2-1155s1c1
Sequence:CCGGGCACCAGTCATTCTTCTTCTACTCGAGTAGAAGAAGAATGACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010331.2-1070s1c1
Sequence:CCGGTCCGCCAATACAAGTATGATTCTCGAGAATCATACTTGTATTGGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010331
VALIDATED
GPAA1 MISSION shRNA shRNA Plasmid DNA
glycosylphosphatidylinositol anchor attachment 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-1155s21c1
Sequence:CCGGGCACCAGTCATTCTTCTTCTACTCGAGTAGAAGAAGAATGACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-1492s21c1
Sequence:CCGGTTGACGCTGCTCGCGATTTATCTCGAGATAAATCGCGAGCAGCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-1046s21c1
Sequence:CCGGTAACCCTACGCGGCATCAATACTCGAGTATTGATGCCGCGTAGGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-444s21c1
Sequence:CCGGTGAGACCCACGAGCGCTATATCTCGAGATATAGCGCTCGTGGGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-684s21c1
Sequence:CCGGCGAAGCCTACCATGACATTAACTCGAGTTAATGTCATGGTAGGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010331.2-1071s1c1
Sequence:CCGGCCGCCAATACAAGTATGATTTCTCGAGAAATCATACTTGTATTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010331.2-684s1c1
Sequence:CCGGCGAAGCCTACCATGACATTAACTCGAGTTAATGTCATGGTAGGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010331.2-1861s1c1
Sequence:CCGGGTGCTGGAACACTACACCTATCTCGAGATAGGTGTAGTGTTCCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010331.2-1155s1c1
Sequence:CCGGGCACCAGTCATTCTTCTTCTACTCGAGTAGAAGAAGAATGACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010331.2-1070s1c1
Sequence:CCGGTCCGCCAATACAAGTATGATTCTCGAGAATCATACTTGTATTGGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010331
VALIDATED
GPAA1 MISSION shRNA Lentiviral Transduction Particles
glycosylphosphatidylinositol anchor attachment 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-1155s21c1
Sequence:CCGGGCACCAGTCATTCTTCTTCTACTCGAGTAGAAGAAGAATGACTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-1492s21c1
Sequence:CCGGTTGACGCTGCTCGCGATTTATCTCGAGATAAATCGCGAGCAGCGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-1046s21c1
Sequence:CCGGTAACCCTACGCGGCATCAATACTCGAGTATTGATGCCGCGTAGGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-444s21c1
Sequence:CCGGTGAGACCCACGAGCGCTATATCTCGAGATATAGCGCTCGTGGGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010331.2-684s21c1
Sequence:CCGGCGAAGCCTACCATGACATTAACTCGAGTTAATGTCATGGTAGGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010331.2-1071s1c1
Sequence:CCGGCCGCCAATACAAGTATGATTTCTCGAGAAATCATACTTGTATTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010331.2-684s1c1
Sequence:CCGGCGAAGCCTACCATGACATTAACTCGAGTTAATGTCATGGTAGGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010331.2-1861s1c1
Sequence:CCGGGTGCTGGAACACTACACCTATCTCGAGATAGGTGTAGTGTTCCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010331.2-1155s1c1
Sequence:CCGGGCACCAGTCATTCTTCTTCTACTCGAGTAGAAGAAGAATGACTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010331.2-1070s1c1
Sequence:CCGGTCCGCCAATACAAGTATGATTCTCGAGAATCATACTTGTATTGGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003801
VALIDATED
GPAA1 MISSION shRNA Bacterial Glycerol Stock
glycosylphosphatidylinositol anchor attachment 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-458s21c1
Sequence:CCGGTGAGACCCACGAGCGCTATATCTCGAGATATAGCGCTCGTGGGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-698s21c1
Sequence:CCGGTGAAGCCTACCACGATGTCAACTCGAGTTGACATCGTGGTAGGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-1505s21c1
Sequence:CCGGGCTGACACTGCTGGCGATTTACTCGAGTAAATCGCCAGCAGTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-414s21c1
Sequence:CCGGGAGGTCTACACGCAGAGTTTCCTCGAGGAAACTCTGCGTGTAGACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003801.3-646s21c1
Sequence:CCGGATATCGTCTTCCTGGTAACAGCTCGAGCTGTTACCAGGAAGACGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003801.2-612s1c1
Sequence:CCGGCAGATTTATTGGGCCAAAGATCTCGAGATCTTTGGCCCAATAAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003801
VALIDATED
GPAA1 MISSION shRNA shRNA Plasmid DNA
glycosylphosphatidylinositol anchor attachment 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-458s21c1
Sequence:CCGGTGAGACCCACGAGCGCTATATCTCGAGATATAGCGCTCGTGGGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-698s21c1
Sequence:CCGGTGAAGCCTACCACGATGTCAACTCGAGTTGACATCGTGGTAGGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-1505s21c1
Sequence:CCGGGCTGACACTGCTGGCGATTTACTCGAGTAAATCGCCAGCAGTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-414s21c1
Sequence:CCGGGAGGTCTACACGCAGAGTTTCCTCGAGGAAACTCTGCGTGTAGACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003801.3-646s21c1
Sequence:CCGGATATCGTCTTCCTGGTAACAGCTCGAGCTGTTACCAGGAAGACGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003801.2-612s1c1
Sequence:CCGGCAGATTTATTGGGCCAAAGATCTCGAGATCTTTGGCCCAATAAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003801
VALIDATED
GPAA1 MISSION shRNA Lentiviral Transduction Particles
glycosylphosphatidylinositol anchor attachment 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-458s21c1
Sequence:CCGGTGAGACCCACGAGCGCTATATCTCGAGATATAGCGCTCGTGGGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-698s21c1
Sequence:CCGGTGAAGCCTACCACGATGTCAACTCGAGTTGACATCGTGGTAGGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-1505s21c1
Sequence:CCGGGCTGACACTGCTGGCGATTTACTCGAGTAAATCGCCAGCAGTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003801.3-414s21c1
Sequence:CCGGGAGGTCTACACGCAGAGTTTCCTCGAGGAAACTCTGCGTGTAGACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003801.3-646s21c1
Sequence:CCGGATATCGTCTTCCTGGTAACAGCTCGAGCTGTTACCAGGAAGACGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003801.2-612s1c1
Sequence:CCGGCAGATTTATTGGGCCAAAGATCTCGAGATCTTTGGCCCAATAAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)