EMAIL THIS PAGE TO A FRIEND

GPALPP1

GPALPP motifs containing 1

Synonyms: KIAA1704 LSR7 RP11-245H20.2 bA245H20.2
Gene ID:
Mouse(67467) GPALPP motifs containing 1
Zebrafish(445079) GPALPP motifs containing 1
dog(609189) GPALPP motifs containing 1
chicken(418842) GPALPP motifs containing 1
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018559 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018559 Rosetta Predictions human pricing
NM_026177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352110 predicted 654
2 SASI_Hs01_00077928 predicted 924
3 SASI_Hs01_00077929 predicted 866
4 SASI_Hs01_00077930 predicted 705
5 SASI_Hs02_00352111 predicted 747
6 SASI_Hs01_00077931 predicted 982
7 SASI_Hs01_00077932 predicted 981
8 SASI_Hs01_00077933 predicted 766
9 SASI_Hs01_00077934 predicted 978
10 SASI_Hs01_00077936 predicted 656
11 SASI_Hs01_00077935 predicted 637
12 SASI_Hs01_00077937 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329816 predicted 944
2 SASI_Mm01_00050595 predicted 263
3 SASI_Mm01_00050596 predicted 509
4 SASI_Mm01_00050597 predicted 1032
5 SASI_Mm01_00050598 predicted 661
6 SASI_Mm01_00050599 predicted 658
7 SASI_Mm01_00050601 predicted 875
8 SASI_Mm01_00050603 predicted 335
9 SASI_Mm01_00050604 predicted 965
10 SASI_Mm02_00329817 predicted 589
11 SASI_Mm01_00050600 predicted 857
12 SASI_Mm01_00050602 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018559
GPALPP1 MISSION shRNA Bacterial Glycerol Stock
GPALPP motifs containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-341s1c1
Sequence:CCGGCAGGATGATGACGATGATGATCTCGAGATCATCATCGTCATCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-1022s1c1
Sequence:CCGGCTCAAGGTTAATCGGTTTGATCTCGAGATCAAACCGATTAACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-996s1c1
Sequence:CCGGGAATACCATTTGACCGTGATACTCGAGTATCACGGTCAAATGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-689s1c1
Sequence:CCGGCCTCCAGAAATGAAAGACTTTCTCGAGAAAGTCTTTCATTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-1019s1c1
Sequence:CCGGGATCTCAAGGTTAATCGGTTTCTCGAGAAACCGATTAACCTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018559.2-749s21c1
Sequence:CCGGACATCTGGAGATCGATCAATCCTCGAGGATTGATCGATCTCCAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018559.2-1097s21c1
Sequence:CCGGTCACACGGCAAAGGCAATATGCTCGAGCATATTGCCTTTGCCGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018559
GPALPP1 MISSION shRNA shRNA Plasmid DNA
GPALPP motifs containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-341s1c1
Sequence:CCGGCAGGATGATGACGATGATGATCTCGAGATCATCATCGTCATCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-1022s1c1
Sequence:CCGGCTCAAGGTTAATCGGTTTGATCTCGAGATCAAACCGATTAACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-996s1c1
Sequence:CCGGGAATACCATTTGACCGTGATACTCGAGTATCACGGTCAAATGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-689s1c1
Sequence:CCGGCCTCCAGAAATGAAAGACTTTCTCGAGAAAGTCTTTCATTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-1019s1c1
Sequence:CCGGGATCTCAAGGTTAATCGGTTTCTCGAGAAACCGATTAACCTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018559.2-749s21c1
Sequence:CCGGACATCTGGAGATCGATCAATCCTCGAGGATTGATCGATCTCCAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018559.2-1097s21c1
Sequence:CCGGTCACACGGCAAAGGCAATATGCTCGAGCATATTGCCTTTGCCGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018559
GPALPP1 MISSION shRNA Lentiviral Transduction Particles
GPALPP motifs containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-341s1c1
Sequence:CCGGCAGGATGATGACGATGATGATCTCGAGATCATCATCGTCATCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-1022s1c1
Sequence:CCGGCTCAAGGTTAATCGGTTTGATCTCGAGATCAAACCGATTAACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-996s1c1
Sequence:CCGGGAATACCATTTGACCGTGATACTCGAGTATCACGGTCAAATGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-689s1c1
Sequence:CCGGCCTCCAGAAATGAAAGACTTTCTCGAGAAAGTCTTTCATTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018559.2-1019s1c1
Sequence:CCGGGATCTCAAGGTTAATCGGTTTCTCGAGAAACCGATTAACCTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018559.2-749s21c1
Sequence:CCGGACATCTGGAGATCGATCAATCCTCGAGGATTGATCGATCTCCAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018559.2-1097s21c1
Sequence:CCGGTCACACGGCAAAGGCAATATGCTCGAGCATATTGCCTTTGCCGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026177
VALIDATED
GPALPP1 MISSION shRNA Bacterial Glycerol Stock
GPALPP motifs containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.2-393s1c1
Sequence:CCGGGCCTATAATAGGTCCCGCATTCTCGAGAATGCGGGACCTATTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.2-873s1c1
Sequence:CCGGCGAGCAAGTATCCTCATACAACTCGAGTTGTATGAGGATACTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.2-247s1c1
Sequence:CCGGGAAGGCAATCAAGAGTCTGAACTCGAGTTCAGACTCTTGATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026177.3-2591s1c1
Sequence:CCGGCCAAACTGAACCTAGTCTATACTCGAGTATAGACTAGGTTCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.3-1039s1c1
Sequence:CCGGGATAAAGATCTCAAGGTTAATCTCGAGATTAACCTTGAGATCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026177.3-1024s21c1
Sequence:CCGGATACCATTTGACCGTGATAAACTCGAGTTTATCACGGTCAAATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026177.3-421s21c1
Sequence:CCGGTCTCCTCCCAGGCCTATAATACTCGAGTATTATAGGCCTGGGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026177.3-547s21c1
Sequence:CCGGAGCGGTGAAGATGAGGATATTCTCGAGAATATCCTCATCTTCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026177.3-1705s21c1
Sequence:CCGGTACGCCTTAAATATCCATAATCTCGAGATTATGGATATTTAAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026177.3-954s21c1
Sequence:CCGGCCTCATGGACATTCATCATAACTCGAGTTATGATGAATGTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026177
VALIDATED
GPALPP1 MISSION shRNA shRNA Plasmid DNA
GPALPP motifs containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.2-393s1c1
Sequence:CCGGGCCTATAATAGGTCCCGCATTCTCGAGAATGCGGGACCTATTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.2-873s1c1
Sequence:CCGGCGAGCAAGTATCCTCATACAACTCGAGTTGTATGAGGATACTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.2-247s1c1
Sequence:CCGGGAAGGCAATCAAGAGTCTGAACTCGAGTTCAGACTCTTGATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026177.3-2591s1c1
Sequence:CCGGCCAAACTGAACCTAGTCTATACTCGAGTATAGACTAGGTTCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.3-1039s1c1
Sequence:CCGGGATAAAGATCTCAAGGTTAATCTCGAGATTAACCTTGAGATCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026177.3-1024s21c1
Sequence:CCGGATACCATTTGACCGTGATAAACTCGAGTTTATCACGGTCAAATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026177.3-421s21c1
Sequence:CCGGTCTCCTCCCAGGCCTATAATACTCGAGTATTATAGGCCTGGGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026177.3-547s21c1
Sequence:CCGGAGCGGTGAAGATGAGGATATTCTCGAGAATATCCTCATCTTCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026177.3-1705s21c1
Sequence:CCGGTACGCCTTAAATATCCATAATCTCGAGATTATGGATATTTAAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026177.3-954s21c1
Sequence:CCGGCCTCATGGACATTCATCATAACTCGAGTTATGATGAATGTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026177
VALIDATED
GPALPP1 MISSION shRNA Lentiviral Transduction Particles
GPALPP motifs containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.2-393s1c1
Sequence:CCGGGCCTATAATAGGTCCCGCATTCTCGAGAATGCGGGACCTATTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.2-873s1c1
Sequence:CCGGCGAGCAAGTATCCTCATACAACTCGAGTTGTATGAGGATACTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.2-247s1c1
Sequence:CCGGGAAGGCAATCAAGAGTCTGAACTCGAGTTCAGACTCTTGATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026177.3-2591s1c1
Sequence:CCGGCCAAACTGAACCTAGTCTATACTCGAGTATAGACTAGGTTCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026177.3-1039s1c1
Sequence:CCGGGATAAAGATCTCAAGGTTAATCTCGAGATTAACCTTGAGATCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026177.3-1024s21c1
Sequence:CCGGATACCATTTGACCGTGATAAACTCGAGTTTATCACGGTCAAATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026177.3-421s21c1
Sequence:CCGGTCTCCTCCCAGGCCTATAATACTCGAGTATTATAGGCCTGGGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026177.3-547s21c1
Sequence:CCGGAGCGGTGAAGATGAGGATATTCTCGAGAATATCCTCATCTTCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026177.3-1705s21c1
Sequence:CCGGTACGCCTTAAATATCCATAATCTCGAGATTATGGATATTTAAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026177.3-954s21c1
Sequence:CCGGCCTCATGGACATTCATCATAACTCGAGTTATGATGAATGTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks