EMAIL THIS PAGE TO A FRIEND

GPAM

glycerol-3-phosphate acyltransferase, mitochondrial

209 Gene Product Result for
Synonyms: GPAT GPAT1
UniProtKB ID: Q9HCL2, Q5VW51, Q86TA3
Gene ID:
Human(57678) Summary: This gene encodes a mitochondrial enzyme which prefers saturated fatty acids as its substrate for the synthesis of glycerolipids. This metabolic pathway's first step is catalyzed by the encoded enzyme. Two forms for this enzyme exist, one in the mitochondria and one in the endoplasmic reticulum. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(14732) glycerol-3-phosphate acyltransferase, mitochondrial
Rat(29653) glycerol-3-phosphate acyltransferase, mitochondrial
sheep(101120972) glycerol-3-phosphate acyltransferase, mitochondrial
Domestic Rabbit(100356320) glycerol-3-phosphate acyltransferase, mitochondrial
domestic guinea pig(100716192) glycerol-3-phosphate acyltransferase, mitochondrial
naked mole-rat(101722717) glycerol-3-phosphate acyltransferase, mitochondrial
Zebrafish(100332911) glycerol-3-phosphate acyltransferase, mitochondrial
chicken(423895) glycerol-3-phosphate acyltransferase, mitochondrial
dog(486890) glycerol-3-phosphate acyltransferase, mitochondrial
domestic cat(101094629) glycerol-3-phosphate acyltransferase, mitochondrial
Horse(100068677) glycerol-3-phosphate acyltransferase, mitochondrial
cow(497202) glycerol-3-phosphate acyltransferase, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020918 Rosetta Predictions human pricing
NM_017274 Rosetta Predictions rat pricing
NM_008149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197560 predicted 1343
2 SASI_Hs01_00197561 predicted 1322
3 SASI_Hs01_00197562 predicted 553
4 SASI_Hs01_00197565 predicted 2010
5 SASI_Hs01_00197566 predicted 1212
6 SASI_Hs02_00354280 predicted 2140
7 SASI_Hs01_00197567 predicted 1189
8 SASI_Hs01_00197568 predicted 547
9 SASI_Hs02_00354281 predicted 975
10 SASI_Hs01_00197569 predicted 1778
11 SASI_Hs01_00197563 predicted 1695
12 SASI_Hs01_00197564 predicted 2650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119753 predicted 810
2 SASI_Rn02_00261682 predicted 1752
3 SASI_Rn01_00119755 predicted 1501
4 SASI_Rn01_00119757 predicted 1805
5 SASI_Rn01_00119758 predicted 1221
6 SASI_Rn02_00261683 predicted 769
7 SASI_Rn02_00261684 predicted 1277
8 SASI_Rn01_00119759 predicted 541
9 SASI_Rn01_00119760 predicted 204
10 SASI_Rn01_00119761 predicted 1922
11 SASI_Rn01_00119752 predicted 2202
12 SASI_Rn01_00119754 predicted 1243
13 SASI_Rn01_00119756 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107319 predicted 1861
2 SASI_Mm01_00107320 predicted 1482
3 SASI_Mm01_00107321 predicted 900
4 SASI_Mm01_00107322 predicted 1232
5 SASI_Mm01_00107323 predicted 519
6 SASI_Mm01_00107324 predicted 2419
7 SASI_Mm02_00313248 predicted 1752
8 SASI_Mm01_00107325 predicted 1217
9 SASI_Mm01_00107326 predicted 2105
10 SASI_Mm01_00107327 predicted 2022
11 SASI_Mm01_00107318 predicted 2596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020918
VALIDATED
GPAM MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate acyltransferase, mitochondrial
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-1026s21c1
Sequence:CCGGACGACGAAGGCTCGATGAAACCTCGAGGTTTCATCGAGCCTTCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020918.4-2904s21c1
Sequence:CCGGCCTCTATTCGCAACTCATAATCTCGAGATTATGAGTTGCGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-1337s21c1
Sequence:CCGGGTGTAGCAAGAGGTGTTATTACTCGAGTAATAACACCTCTTGCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020918.4-3067s21c1
Sequence:CCGGCTTAGTGCTGCTGGGTAATTTCTCGAGAAATTACCCAGCAGCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-1528s21c1
Sequence:CCGGGGTAGAGACACGTCCATTAATCTCGAGATTAATGGACGTGTCTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-880s21c1
Sequence:CCGGCCAGTTCATAGATCCCATATTCTCGAGAATATGGGATCTATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-635s1c1
Sequence:CCGGGCTGCTGAATTAAACCCTGATCTCGAGATCAGGGTTTAATTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-1471s1c1
Sequence:CCGGGCAAGCGTTGTTACCAGCTATCTCGAGATAGCTGGTAACAACGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-1813s1c1
Sequence:CCGGGCTGGGAAATTGTGTCACAATCTCGAGATTGTGACACAATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020918.2-2338s1c1
Sequence:CCGGCCAGCAGTTTATCACCTTCTTCTCGAGAAGAAGGTGATAAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-979s1c1
Sequence:CCGGCCCAATCTTCAGTACCTTGATCTCGAGATCAAGGTACTGAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020918
VALIDATED
GPAM MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate acyltransferase, mitochondrial
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-1026s21c1
Sequence:CCGGACGACGAAGGCTCGATGAAACCTCGAGGTTTCATCGAGCCTTCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020918.4-2904s21c1
Sequence:CCGGCCTCTATTCGCAACTCATAATCTCGAGATTATGAGTTGCGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-1337s21c1
Sequence:CCGGGTGTAGCAAGAGGTGTTATTACTCGAGTAATAACACCTCTTGCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020918.4-3067s21c1
Sequence:CCGGCTTAGTGCTGCTGGGTAATTTCTCGAGAAATTACCCAGCAGCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-1528s21c1
Sequence:CCGGGGTAGAGACACGTCCATTAATCTCGAGATTAATGGACGTGTCTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-880s21c1
Sequence:CCGGCCAGTTCATAGATCCCATATTCTCGAGAATATGGGATCTATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-635s1c1
Sequence:CCGGGCTGCTGAATTAAACCCTGATCTCGAGATCAGGGTTTAATTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-1471s1c1
Sequence:CCGGGCAAGCGTTGTTACCAGCTATCTCGAGATAGCTGGTAACAACGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-1813s1c1
Sequence:CCGGGCTGGGAAATTGTGTCACAATCTCGAGATTGTGACACAATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020918.2-2338s1c1
Sequence:CCGGCCAGCAGTTTATCACCTTCTTCTCGAGAAGAAGGTGATAAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-979s1c1
Sequence:CCGGCCCAATCTTCAGTACCTTGATCTCGAGATCAAGGTACTGAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020918
VALIDATED
GPAM MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate acyltransferase, mitochondrial
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-1026s21c1
Sequence:CCGGACGACGAAGGCTCGATGAAACCTCGAGGTTTCATCGAGCCTTCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020918.4-2904s21c1
Sequence:CCGGCCTCTATTCGCAACTCATAATCTCGAGATTATGAGTTGCGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-1337s21c1
Sequence:CCGGGTGTAGCAAGAGGTGTTATTACTCGAGTAATAACACCTCTTGCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020918.4-3067s21c1
Sequence:CCGGCTTAGTGCTGCTGGGTAATTTCTCGAGAAATTACCCAGCAGCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-1528s21c1
Sequence:CCGGGGTAGAGACACGTCCATTAATCTCGAGATTAATGGACGTGTCTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020918.4-880s21c1
Sequence:CCGGCCAGTTCATAGATCCCATATTCTCGAGAATATGGGATCTATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-635s1c1
Sequence:CCGGGCTGCTGAATTAAACCCTGATCTCGAGATCAGGGTTTAATTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-1471s1c1
Sequence:CCGGGCAAGCGTTGTTACCAGCTATCTCGAGATAGCTGGTAACAACGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-1813s1c1
Sequence:CCGGGCTGGGAAATTGTGTCACAATCTCGAGATTGTGACACAATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020918.2-2338s1c1
Sequence:CCGGCCAGCAGTTTATCACCTTCTTCTCGAGAAGAAGGTGATAAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_020918.2-979s1c1
Sequence:CCGGCCCAATCTTCAGTACCTTGATCTCGAGATCAAGGTACTGAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008149
VALIDATED
GPAM MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate acyltransferase, mitochondrial
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008149.3-1214s21c1
Sequence:CCGGATCTCGTATGATCGCATAATCCTCGAGGATTATGCGATCATACGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-2852s21c1
Sequence:CCGGATTCATGATCACTAGGTTATACTCGAGTATAACCTAGTGATCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-1463s21c1
Sequence:CCGGCCGAATGATGTTGCTGATGAACTCGAGTTCATCAGCAACATCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008149.3-2594s21c1
Sequence:CCGGCGGCAGAAACTCCTAGAGTATCTCGAGATACTCTAGGAGTTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-1746s21c1
Sequence:CCGGATGTCGTCATGCATGCTATTCCTCGAGGAATAGCATGCATGACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-2967s21c1
Sequence:CCGGTTGTAGAACTGACTCTTATATCTCGAGATATAAGAGTCAGTTCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008149.2-2256s1c1
Sequence:CCGGGCAGCGAGATTGCTATCTCAACTCGAGTTGAGATAGCAATCTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008149.2-1468s1c1
Sequence:CCGGCCGAATGATGTTGCTGATGAACTCGAGTTCATCAGCAACATCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008149.2-2599s1c1
Sequence:CCGGCGGCAGAAACTCCTAGAGTATCTCGAGATACTCTAGGAGTTTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008149.2-535s1c1
Sequence:CCGGGCCACCAGTGTTACTGAGAATCTCGAGATTCTCAGTAACACTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008149.2-3599s1c1
Sequence:CCGGGCCATGTAAAGGCGAGTGATTCTCGAGAATCACTCGCCTTTACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008149
VALIDATED
GPAM MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate acyltransferase, mitochondrial
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008149.3-1214s21c1
Sequence:CCGGATCTCGTATGATCGCATAATCCTCGAGGATTATGCGATCATACGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-2852s21c1
Sequence:CCGGATTCATGATCACTAGGTTATACTCGAGTATAACCTAGTGATCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-1463s21c1
Sequence:CCGGCCGAATGATGTTGCTGATGAACTCGAGTTCATCAGCAACATCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008149.3-2594s21c1
Sequence:CCGGCGGCAGAAACTCCTAGAGTATCTCGAGATACTCTAGGAGTTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-1746s21c1
Sequence:CCGGATGTCGTCATGCATGCTATTCCTCGAGGAATAGCATGCATGACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-2967s21c1
Sequence:CCGGTTGTAGAACTGACTCTTATATCTCGAGATATAAGAGTCAGTTCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008149.2-2256s1c1
Sequence:CCGGGCAGCGAGATTGCTATCTCAACTCGAGTTGAGATAGCAATCTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008149.2-1468s1c1
Sequence:CCGGCCGAATGATGTTGCTGATGAACTCGAGTTCATCAGCAACATCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008149.2-2599s1c1
Sequence:CCGGCGGCAGAAACTCCTAGAGTATCTCGAGATACTCTAGGAGTTTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008149.2-535s1c1
Sequence:CCGGGCCACCAGTGTTACTGAGAATCTCGAGATTCTCAGTAACACTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008149.2-3599s1c1
Sequence:CCGGGCCATGTAAAGGCGAGTGATTCTCGAGAATCACTCGCCTTTACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008149
VALIDATED
GPAM MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate acyltransferase, mitochondrial
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008149.3-1214s21c1
Sequence:CCGGATCTCGTATGATCGCATAATCCTCGAGGATTATGCGATCATACGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-2852s21c1
Sequence:CCGGATTCATGATCACTAGGTTATACTCGAGTATAACCTAGTGATCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-1463s21c1
Sequence:CCGGCCGAATGATGTTGCTGATGAACTCGAGTTCATCAGCAACATCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008149.3-2594s21c1
Sequence:CCGGCGGCAGAAACTCCTAGAGTATCTCGAGATACTCTAGGAGTTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-1746s21c1
Sequence:CCGGATGTCGTCATGCATGCTATTCCTCGAGGAATAGCATGCATGACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008149.3-2967s21c1
Sequence:CCGGTTGTAGAACTGACTCTTATATCTCGAGATATAAGAGTCAGTTCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008149.2-2256s1c1
Sequence:CCGGGCAGCGAGATTGCTATCTCAACTCGAGTTGAGATAGCAATCTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008149.2-1468s1c1
Sequence:CCGGCCGAATGATGTTGCTGATGAACTCGAGTTCATCAGCAACATCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008149.2-2599s1c1
Sequence:CCGGCGGCAGAAACTCCTAGAGTATCTCGAGATACTCTAGGAGTTTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008149.2-535s1c1
Sequence:CCGGGCCACCAGTGTTACTGAGAATCTCGAGATTCTCAGTAACACTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008149.2-3599s1c1
Sequence:CCGGGCCATGTAAAGGCGAGTGATTCTCGAGAATCACTCGCCTTTACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks