EMAIL THIS PAGE TO A FRIEND

GPANK1

G patch domain and ankyrin repeats 1

56 Gene Product Result for
Synonyms: ANKRD59 BAT4 D6S54E G5 GPATCH10
UniProtKB ID: O95872, A6NG25, B0UXA2, Q5SQ49
Gene ID:
Human(7918) Summary: This gene is located in a cluster of HLA-B-associated transcripts, which is included in the human major histocompatability complex III region. This gene encodes a protein which is thought to play a role in immunity. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2010]
Mouse(81845) G patch domain and ankyrin repeats 1
Rat(415064) G patch domain and ankyrin repeats 1
domestic cat(101087403) G patch domain and ankyrin repeats 1
cow(617553) G patch domain and ankyrin repeats 1
dog(481714) G patch domain and ankyrin repeats 1
domestic guinea pig(100732496) G patch domain and ankyrin repeats 1
naked mole-rat(101708294) G patch domain and ankyrin repeats 1
sheep(101120117) G patch domain and ankyrin repeats 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033177 Rosetta Predictions human pricing
NM_001034157 Rosetta Predictions rat pricing
NM_001128597 Rosetta Predictions mouse pricing
NM_032460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128087 predicted 1296
2 SASI_Hs01_00128088 predicted 1289
3 SASI_Hs01_00128089 predicted 1281
4 SASI_Hs01_00128090 predicted 1240
5 SASI_Hs01_00128091 predicted 1343
6 SASI_Hs01_00128092 predicted 1300
7 SASI_Hs01_00128093 predicted 1519
8 SASI_Hs01_00128094 predicted 1552
9 SASI_Hs01_00128095 predicted 1241
10 SASI_Hs01_00128096 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072037 predicted 682
2 SASI_Rn01_00072038 predicted 853
3 SASI_Rn01_00072039 predicted 259
4 SASI_Rn01_00072040 predicted 854
5 SASI_Rn01_00072041 predicted 966
6 SASI_Rn01_00072042 predicted 642
7 SASI_Rn01_00072043 predicted 635
8 SASI_Rn01_00072044 predicted 478
9 SASI_Rn01_00072045 predicted 540
10 SASI_Rn01_00072046 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310678 predicted 982
2 SASI_Mm02_00310679 predicted 1152
3 SASI_Mm02_00310680 predicted 696
4 SASI_Mm02_00310681 predicted 837
5 SASI_Mm02_00310682 predicted 1257
6 SASI_Mm02_00310683 predicted 1204
7 SASI_Mm02_00310684 predicted 1229
8 SASI_Mm02_00310685 predicted 923
9 SASI_Mm02_00310686 predicted 940
10 SASI_Mm02_00310687 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184742 predicted 779
2 SASI_Mm01_00184743 predicted 955
3 SASI_Mm01_00184744 predicted 496
4 SASI_Mm01_00184745 predicted 639
5 SASI_Mm01_00184746 predicted 1062
6 SASI_Mm01_00184747 predicted 994
7 SASI_Mm01_00184748 predicted 1025
8 SASI_Mm01_00184750 predicted 725
9 SASI_Mm02_00337248 predicted 732
10 SASI_Mm02_00337249 predicted 394
11 SASI_Mm01_00184741 predicted 1125
12 SASI_Mm01_00184749 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033177
VALIDATED
GPANK1 MISSION shRNA Bacterial Glycerol Stock
G patch domain and ankyrin repeats 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_033177.2-1311s1c1
Sequence:CCGGCACCCACTTCCAAGATTCCAACTCGAGTTGGAATCTTGGAAGTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-936s1c1
Sequence:CCGGCCTTGAGGCTGAGGATAAGATCTCGAGATCTTATCCTCAGCCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_033177.2-1525s1c1
Sequence:CCGGGAAGGACTAGGCTACAGATCACTCGAGTGATCTGTAGCCTAGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033177.2-914s1c1
Sequence:CCGGGAAGACATGGACAAGGGAGATCTCGAGATCTCCCTTGTCCATGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_033177.2-943s1c1
Sequence:CCGGGCTGAGGATAAGATGACTCACCTCGAGGTGAGTCATCTTATCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033177.2-1559s1c1
Sequence:CCGGGAGTGACACATTTCCCAGCTTCTCGAGAAGCTGGGAAATGTGTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-1680s1c1
Sequence:CCGGGCGGGATCTAAGGACTTACATCTCGAGATGTAAGTCCTTAGATCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033177.2-907s1c1
Sequence:CCGGGCATCAGGAAGACATGGACAACTCGAGTTGTCCATGTCTTCCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-949s1c1
Sequence:CCGGGATAAGATGACTCACCGGATACTCGAGTATCCGGTGAGTCATCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-836s1c1
Sequence:CCGGCTGCCAGAGAAAGAAAGAGAACTCGAGTTCTCTTTCTTTCTCTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033177.2-1735s21c1
Sequence:CCGGCTAGTCTGCTGCTGAAGTCTGCTCGAGCAGACTTCAGCAGCAGACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-1520s21c1
Sequence:CCGGACCAGGAAGGACTAGGCTACACTCGAGTGTAGCCTAGTCCTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-1706s21c1
Sequence:CCGGTCGAGTTCTGACTTTGGTAAACTCGAGTTTACCAAAGTCAGAACTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-1678s21c1
Sequence:CCGGGAGCGGGATCTAAGGACTTACCTCGAGGTAAGTCCTTAGATCCCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-934s21c1
Sequence:CCGGTCCCTTGAGGCTGAGGATAAGCTCGAGCTTATCCTCAGCCTCAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033177
VALIDATED
GPANK1 MISSION shRNA shRNA Plasmid DNA
G patch domain and ankyrin repeats 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_033177.2-1311s1c1
Sequence:CCGGCACCCACTTCCAAGATTCCAACTCGAGTTGGAATCTTGGAAGTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-936s1c1
Sequence:CCGGCCTTGAGGCTGAGGATAAGATCTCGAGATCTTATCCTCAGCCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_033177.2-1525s1c1
Sequence:CCGGGAAGGACTAGGCTACAGATCACTCGAGTGATCTGTAGCCTAGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033177.2-914s1c1
Sequence:CCGGGAAGACATGGACAAGGGAGATCTCGAGATCTCCCTTGTCCATGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_033177.2-943s1c1
Sequence:CCGGGCTGAGGATAAGATGACTCACCTCGAGGTGAGTCATCTTATCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033177.2-1559s1c1
Sequence:CCGGGAGTGACACATTTCCCAGCTTCTCGAGAAGCTGGGAAATGTGTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-1680s1c1
Sequence:CCGGGCGGGATCTAAGGACTTACATCTCGAGATGTAAGTCCTTAGATCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033177.2-907s1c1
Sequence:CCGGGCATCAGGAAGACATGGACAACTCGAGTTGTCCATGTCTTCCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-949s1c1
Sequence:CCGGGATAAGATGACTCACCGGATACTCGAGTATCCGGTGAGTCATCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-836s1c1
Sequence:CCGGCTGCCAGAGAAAGAAAGAGAACTCGAGTTCTCTTTCTTTCTCTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033177.2-1735s21c1
Sequence:CCGGCTAGTCTGCTGCTGAAGTCTGCTCGAGCAGACTTCAGCAGCAGACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-1520s21c1
Sequence:CCGGACCAGGAAGGACTAGGCTACACTCGAGTGTAGCCTAGTCCTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-1706s21c1
Sequence:CCGGTCGAGTTCTGACTTTGGTAAACTCGAGTTTACCAAAGTCAGAACTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-1678s21c1
Sequence:CCGGGAGCGGGATCTAAGGACTTACCTCGAGGTAAGTCCTTAGATCCCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-934s21c1
Sequence:CCGGTCCCTTGAGGCTGAGGATAAGCTCGAGCTTATCCTCAGCCTCAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033177
VALIDATED
GPANK1 MISSION shRNA Lentiviral Transduction Particles
G patch domain and ankyrin repeats 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_033177.2-1311s1c1
Sequence:CCGGCACCCACTTCCAAGATTCCAACTCGAGTTGGAATCTTGGAAGTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-936s1c1
Sequence:CCGGCCTTGAGGCTGAGGATAAGATCTCGAGATCTTATCCTCAGCCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_033177.2-1525s1c1
Sequence:CCGGGAAGGACTAGGCTACAGATCACTCGAGTGATCTGTAGCCTAGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033177.2-914s1c1
Sequence:CCGGGAAGACATGGACAAGGGAGATCTCGAGATCTCCCTTGTCCATGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_033177.2-943s1c1
Sequence:CCGGGCTGAGGATAAGATGACTCACCTCGAGGTGAGTCATCTTATCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033177.2-1559s1c1
Sequence:CCGGGAGTGACACATTTCCCAGCTTCTCGAGAAGCTGGGAAATGTGTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-1680s1c1
Sequence:CCGGGCGGGATCTAAGGACTTACATCTCGAGATGTAAGTCCTTAGATCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033177.2-907s1c1
Sequence:CCGGGCATCAGGAAGACATGGACAACTCGAGTTGTCCATGTCTTCCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-949s1c1
Sequence:CCGGGATAAGATGACTCACCGGATACTCGAGTATCCGGTGAGTCATCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033177.2-836s1c1
Sequence:CCGGCTGCCAGAGAAAGAAAGAGAACTCGAGTTCTCTTTCTTTCTCTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033177.2-1735s21c1
Sequence:CCGGCTAGTCTGCTGCTGAAGTCTGCTCGAGCAGACTTCAGCAGCAGACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-1520s21c1
Sequence:CCGGACCAGGAAGGACTAGGCTACACTCGAGTGTAGCCTAGTCCTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-1706s21c1
Sequence:CCGGTCGAGTTCTGACTTTGGTAAACTCGAGTTTACCAAAGTCAGAACTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-1678s21c1
Sequence:CCGGGAGCGGGATCTAAGGACTTACCTCGAGGTAAGTCCTTAGATCCCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033177.2-934s21c1
Sequence:CCGGTCCCTTGAGGCTGAGGATAAGCTCGAGCTTATCCTCAGCCTCAAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032460
VALIDATED
GPANK1 MISSION shRNA Bacterial Glycerol Stock
G patch domain and ankyrin repeats 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032460.1-1240s1c1
Sequence:CCGGCTTAGCTGTTGGGCTCTGATTCTCGAGAATCAGAGCCCAACAGCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032460.1-662s1c1
Sequence:CCGGCGTATGGTCAGAGAGAGTCATCTCGAGATGACTCTCTCTGACCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032460.1-672s1c1
Sequence:CCGGGAGAGAGTCATGGAGAGACAACTCGAGTTGTCTCTCCATGACTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032460.1-230s1c1
Sequence:CCGGCGGGCTTTCTATGAGGCTCTACTCGAGTAGAGCCTCATAGAAAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032460.1-1123s1c1
Sequence:CCGGGCGAGATCTAAGACTGTACATCTCGAGATGTACAGTCTTAGATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032460.2-92s21c1
Sequence:CCGGTCTCTCACAGGCATGTCTAGGCTCGAGCCTAGACATGCCTGTGAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032460.2-755s21c1
Sequence:CCGGTTTGAAGACTCCAACCACCACCTCGAGGTGGTGGTTGGAGTCTTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032460.2-1075s21c1
Sequence:CCGGGAGGGAGAACAGAAGGCAAGACTCGAGTCTTGCCTTCTGTTCTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032460.2-63s21c1
Sequence:CCGGTTGCCTTGCCCAGTCTTCATTCTCGAGAATGAAGACTGGGCAAGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032460.2-771s21c1
Sequence:CCGGACCACACATCTACTGCTCACCCTCGAGGGTGAGCAGTAGATGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032460
VALIDATED
GPANK1 MISSION shRNA shRNA Plasmid DNA
G patch domain and ankyrin repeats 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032460.1-1240s1c1
Sequence:CCGGCTTAGCTGTTGGGCTCTGATTCTCGAGAATCAGAGCCCAACAGCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032460.1-662s1c1
Sequence:CCGGCGTATGGTCAGAGAGAGTCATCTCGAGATGACTCTCTCTGACCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032460.1-672s1c1
Sequence:CCGGGAGAGAGTCATGGAGAGACAACTCGAGTTGTCTCTCCATGACTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032460.1-230s1c1
Sequence:CCGGCGGGCTTTCTATGAGGCTCTACTCGAGTAGAGCCTCATAGAAAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032460.1-1123s1c1
Sequence:CCGGGCGAGATCTAAGACTGTACATCTCGAGATGTACAGTCTTAGATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032460.2-92s21c1
Sequence:CCGGTCTCTCACAGGCATGTCTAGGCTCGAGCCTAGACATGCCTGTGAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032460.2-755s21c1
Sequence:CCGGTTTGAAGACTCCAACCACCACCTCGAGGTGGTGGTTGGAGTCTTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032460.2-1075s21c1
Sequence:CCGGGAGGGAGAACAGAAGGCAAGACTCGAGTCTTGCCTTCTGTTCTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032460.2-63s21c1
Sequence:CCGGTTGCCTTGCCCAGTCTTCATTCTCGAGAATGAAGACTGGGCAAGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032460.2-771s21c1
Sequence:CCGGACCACACATCTACTGCTCACCCTCGAGGGTGAGCAGTAGATGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032460
VALIDATED
GPANK1 MISSION shRNA Lentiviral Transduction Particles
G patch domain and ankyrin repeats 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032460.1-1240s1c1
Sequence:CCGGCTTAGCTGTTGGGCTCTGATTCTCGAGAATCAGAGCCCAACAGCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032460.1-662s1c1
Sequence:CCGGCGTATGGTCAGAGAGAGTCATCTCGAGATGACTCTCTCTGACCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032460.1-672s1c1
Sequence:CCGGGAGAGAGTCATGGAGAGACAACTCGAGTTGTCTCTCCATGACTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032460.1-230s1c1
Sequence:CCGGCGGGCTTTCTATGAGGCTCTACTCGAGTAGAGCCTCATAGAAAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032460.1-1123s1c1
Sequence:CCGGGCGAGATCTAAGACTGTACATCTCGAGATGTACAGTCTTAGATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032460.2-92s21c1
Sequence:CCGGTCTCTCACAGGCATGTCTAGGCTCGAGCCTAGACATGCCTGTGAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032460.2-755s21c1
Sequence:CCGGTTTGAAGACTCCAACCACCACCTCGAGGTGGTGGTTGGAGTCTTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032460.2-1075s21c1
Sequence:CCGGGAGGGAGAACAGAAGGCAAGACTCGAGTCTTGCCTTCTGTTCTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032460.2-63s21c1
Sequence:CCGGTTGCCTTGCCCAGTCTTCATTCTCGAGAATGAAGACTGGGCAAGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032460.2-771s21c1
Sequence:CCGGACCACACATCTACTGCTCACCCTCGAGGGTGAGCAGTAGATGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)