EMAIL THIS PAGE TO A FRIEND

GPAT2

glycerol-3-phosphate acyltransferase 2, mitochondrial

67 Gene Product Result for
Synonyms: CT123
UniProtKB ID: Q6NUI2, Q6P2E4, Q6ZNI3, Q6ZNI5, Q6ZWJ4
Gene ID:
Mouse(215456) glycerol-3-phosphate acyltransferase 2, mitochondrial
Rat(296130) glycerol-3-phosphate acyltransferase 2, mitochondrial
Zebrafish(558437) glycerol-3-phosphate acyltransferase 2, mitochondrial
chicken(426550) glycerol-3-phosphate acyltransferase 2, mitochondrial
Thale Cress(839558) glycerol-3-phosphate sn-2-acyltransferase 2
cow(526739) glycerol-3-phosphate acyltransferase 2, mitochondrial
Horse(100062528) glycerol-3-phosphate acyltransferase 2, mitochondrial
domestic cat(101087986) glycerol-3-phosphate acyltransferase 2, mitochondrial
dog(483053) glycerol-3-phosphate acyltransferase 2, mitochondrial
sheep(101116221) glycerol-3-phosphate acyltransferase 2, mitochondrial
domestic guinea pig(100730092) glycerol-3-phosphate acyltransferase 2, mitochondrial
naked mole-rat(101701339) glycerol-3-phosphate acyltransferase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207328 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207328 Rosetta Predictions human pricing
XM_001078526 Rosetta Predictions rat pricing
XM_238283 Rosetta Predictions rat pricing
NM_001081089 Rosetta Predictions mouse pricing
XM_130488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164715 predicted 1594
2 SASI_Hs01_00164717 predicted 1673
3 SASI_Hs01_00164718 predicted 1214
4 SASI_Hs01_00164719 predicted 1948
5 SASI_Hs01_00164720 predicted 1341
6 SASI_Hs01_00164721 predicted 1448
7 SASI_Hs01_00164722 predicted 2433
8 SASI_Hs01_00164723 predicted 1691
9 SASI_Hs02_00373874 predicted 686
10 SASI_Hs02_00373875 predicted 857
11 SASI_Hs01_00164714 predicted 2167
12 SASI_Hs01_00164716 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361109 predicted 1102
2 SASI_Rn02_00361110 predicted 2239
3 SASI_Rn02_00361111 predicted 1076
4 SASI_Rn02_00361112 predicted 299
5 SASI_Rn02_00361113 predicted 1834
6 SASI_Rn02_00361114 predicted 615
7 SASI_Rn02_00361115 predicted 2064
8 SASI_Rn02_00361116 predicted 2339
9 SASI_Rn02_00361117 predicted 2047
10 SASI_Rn02_00361118 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391296 predicted 2241
2 SASI_Rn02_00391297 predicted 2082
3 SASI_Rn02_00391298 predicted 303
4 SASI_Rn02_00391299 predicted 2058
5 SASI_Rn02_00391300 predicted 2337
6 SASI_Rn02_00391301 predicted 2049
7 SASI_Rn02_00391302 predicted 2066
8 SASI_Rn02_00391303 predicted 2076
9 SASI_Rn02_00391304 predicted 2074
10 SASI_Rn02_00391305 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295071 predicted 2243
2 SASI_Mm02_00295072 predicted 496
3 SASI_Mm02_00295073 predicted 2042
4 SASI_Mm02_00295074 predicted 1328
5 SASI_Mm02_00295075 predicted 2072
6 SASI_Mm02_00295076 predicted 1155
7 SASI_Mm02_00295077 predicted 1841
8 SASI_Mm02_00295078 predicted 769
9 SASI_Mm02_00295079 predicted 521
10 SASI_Mm02_00295080 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247178 predicted 526
2 SASI_Mm01_00247179 predicted 500
3 SASI_Mm01_00247180 predicted 270
4 SASI_Mm01_00247181 predicted 495
5 SASI_Mm01_00247182 predicted 232
6 SASI_Mm01_00247183 predicted 278
7 SASI_Mm01_00247184 predicted 355
8 SASI_Mm01_00247185 predicted 240
9 SASI_Mm01_00247186 predicted 532
10 SASI_Mm01_00247187 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081089
GPAT2 MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate acyltransferase 2, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-1309s21c1
Sequence:CCGGGCCCATTGTGCTAGGTGAATGCTCGAGCATTCACCTAGCACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-1108s21c1
Sequence:CCGGATGTAACATGAACCATGATTTCTCGAGAAATCATGGTTCATGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-2455s21c1
Sequence:CCGGGGACAAGCTGGAACAATTTATCTCGAGATAAATTGTTCCAGCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-359s21c1
Sequence:CCGGGTTCGCAGGCTCTGCTATTTCCTCGAGGAAATAGCAGAGCCTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-2304s21c1
Sequence:CCGGCCCAAGAAGAAGGGATCTTTGCTCGAGCAAAGATCCCTTCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081089
GPAT2 MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate acyltransferase 2, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-1309s21c1
Sequence:CCGGGCCCATTGTGCTAGGTGAATGCTCGAGCATTCACCTAGCACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-1108s21c1
Sequence:CCGGATGTAACATGAACCATGATTTCTCGAGAAATCATGGTTCATGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-2455s21c1
Sequence:CCGGGGACAAGCTGGAACAATTTATCTCGAGATAAATTGTTCCAGCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-359s21c1
Sequence:CCGGGTTCGCAGGCTCTGCTATTTCCTCGAGGAAATAGCAGAGCCTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-2304s21c1
Sequence:CCGGCCCAAGAAGAAGGGATCTTTGCTCGAGCAAAGATCCCTTCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081089
GPAT2 MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate acyltransferase 2, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-1309s21c1
Sequence:CCGGGCCCATTGTGCTAGGTGAATGCTCGAGCATTCACCTAGCACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-1108s21c1
Sequence:CCGGATGTAACATGAACCATGATTTCTCGAGAAATCATGGTTCATGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-2455s21c1
Sequence:CCGGGGACAAGCTGGAACAATTTATCTCGAGATAAATTGTTCCAGCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-359s21c1
Sequence:CCGGGTTCGCAGGCTCTGCTATTTCCTCGAGGAAATAGCAGAGCCTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081089.1-2304s21c1
Sequence:CCGGCCCAAGAAGAAGGGATCTTTGCTCGAGCAAAGATCCCTTCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207328
VALIDATED
GPAT2 MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate acyltransferase 2, mitochondrial
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-405s21c1
Sequence:CCGGCCCTCTTCCACAGAAGCATAACTCGAGTTATGCTTCTGTGGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-1600s21c1
Sequence:CCGGGGTGATGAGCACGGCCATTATCTCGAGATAATGGCCGTGCTCATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-853s21c1
Sequence:CCGGTGGGATCCTGCTGCCCTTTATCTCGAGATAAAGGGCAGCAGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-491s21c1
Sequence:CCGGGTTCGGAGGCTCTGCTATTTCCTCGAGGAAATAGCAGAGCCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-1672s21c1
Sequence:CCGGGCTGACGGAGGAGATACTGTTCTCGAGAACAGTATCTCCTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207328.1-1535s1c1
Sequence:CCGGGCTGCTCTTCAAGCATCAGAACTCGAGTTCTGATGCTTGAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207328.1-2668s1c1
Sequence:CCGGCAGTTCATCCGGCAGTTCATTCTCGAGAATGAACTGCCGGATGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207328.1-2118s1c1
Sequence:CCGGGACTTTACTGATAGTGACAGTCTCGAGACTGTCACTATCAGTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207328
VALIDATED
GPAT2 MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate acyltransferase 2, mitochondrial
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-405s21c1
Sequence:CCGGCCCTCTTCCACAGAAGCATAACTCGAGTTATGCTTCTGTGGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-1600s21c1
Sequence:CCGGGGTGATGAGCACGGCCATTATCTCGAGATAATGGCCGTGCTCATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-853s21c1
Sequence:CCGGTGGGATCCTGCTGCCCTTTATCTCGAGATAAAGGGCAGCAGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-491s21c1
Sequence:CCGGGTTCGGAGGCTCTGCTATTTCCTCGAGGAAATAGCAGAGCCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-1672s21c1
Sequence:CCGGGCTGACGGAGGAGATACTGTTCTCGAGAACAGTATCTCCTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207328.1-1535s1c1
Sequence:CCGGGCTGCTCTTCAAGCATCAGAACTCGAGTTCTGATGCTTGAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207328.1-2668s1c1
Sequence:CCGGCAGTTCATCCGGCAGTTCATTCTCGAGAATGAACTGCCGGATGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207328.1-2118s1c1
Sequence:CCGGGACTTTACTGATAGTGACAGTCTCGAGACTGTCACTATCAGTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207328
VALIDATED
GPAT2 MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate acyltransferase 2, mitochondrial
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-405s21c1
Sequence:CCGGCCCTCTTCCACAGAAGCATAACTCGAGTTATGCTTCTGTGGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-1600s21c1
Sequence:CCGGGGTGATGAGCACGGCCATTATCTCGAGATAATGGCCGTGCTCATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-853s21c1
Sequence:CCGGTGGGATCCTGCTGCCCTTTATCTCGAGATAAAGGGCAGCAGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-491s21c1
Sequence:CCGGGTTCGGAGGCTCTGCTATTTCCTCGAGGAAATAGCAGAGCCTCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207328.2-1672s21c1
Sequence:CCGGGCTGACGGAGGAGATACTGTTCTCGAGAACAGTATCTCCTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207328.1-1535s1c1
Sequence:CCGGGCTGCTCTTCAAGCATCAGAACTCGAGTTCTGATGCTTGAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207328.1-2668s1c1
Sequence:CCGGCAGTTCATCCGGCAGTTCATTCTCGAGAATGAACTGCCGGATGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207328.1-2118s1c1
Sequence:CCGGGACTTTACTGATAGTGACAGTCTCGAGACTGTCACTATCAGTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks