EMAIL THIS PAGE TO A FRIEND

GPATCH11

G patch domain containing 11

68 Gene Product Result for
Synonyms: CCDC75 CENP-Y CENPY
UniProtKB ID: Q8N954, A8K0D9, B7Z2G4, B8ZZ44
Gene ID:
Mouse(53951) G patch domain containing 11
Rat(362685) G patch domain containing 11
domestic guinea pig(100735479) G patch domain containing 11
naked mole-rat(101723885) G patch domain containing 11
Zebrafish(436666) G patch domain containing 11
cow(512655) coiled-coil domain containing 75
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174931 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107271 MISSION® esiRNA esiRNA human CCDC75 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174931 Rosetta Predictions human pricing
NM_001108700 Rosetta Predictions rat pricing
XM_343001 Rosetta Predictions rat pricing
NM_181649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368855 predicted 205
2 SASI_Hs02_00368856 predicted 471
3 SASI_Hs02_00368857 predicted 309
4 SASI_Hs02_00368858 predicted 200
5 SASI_Hs01_00102488 predicted 465
6 SASI_Hs02_00368859 predicted 432
7 SASI_Hs02_00368860 predicted 258
8 SASI_Hs01_00102483 predicted 963
9 SASI_Hs02_00368861 predicted 462
10 SASI_Hs02_00368862 predicted 433
11 SASI_Hs01_00102480 predicted 641
12 SASI_Hs01_00102481 predicted 653
13 SASI_Hs01_00102482 predicted 645
14 SASI_Hs01_00102484 predicted 654
15 SASI_Hs01_00102485 predicted 651
16 SASI_Hs01_00102486 predicted 797
17 SASI_Hs01_00102487 predicted 489
18 SASI_Hs01_00102489 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241215 predicted 1023
2 SASI_Rn02_00241216 predicted 572
3 SASI_Rn02_00241217 predicted 971
4 SASI_Rn02_00241218 predicted 521
5 SASI_Rn02_00241219 predicted 1181
6 SASI_Rn02_00241220 predicted 1254
7 SASI_Rn02_00241221 predicted 1241
8 SASI_Rn02_00241222 predicted 671
9 SASI_Rn02_00241223 predicted 980
10 SASI_Rn02_00241224 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166305 predicted 307
2 SASI_Rn01_00166306 predicted 252
3 SASI_Rn01_00166307 predicted 254
4 SASI_Rn01_00166308 predicted 265
5 SASI_Rn01_00166309 predicted 318
6 SASI_Rn01_00166310 predicted 259
7 SASI_Rn01_00166311 predicted 358
8 SASI_Rn01_00166312 predicted 264
9 SASI_Rn01_00166313 predicted 249
10 SASI_Rn01_00166314 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349872 predicted 637
2 SASI_Mm02_00349873 predicted 316
3 SASI_Mm02_00349874 predicted 1044
4 SASI_Mm02_00349875 predicted 1090
5 SASI_Mm02_00349876 predicted 591
6 SASI_Mm02_00349877 predicted 1137
7 SASI_Mm02_00349878 predicted 504
8 SASI_Mm02_00349879 predicted 944
9 SASI_Mm02_00349880 predicted 1147
10 SASI_Mm02_00349881 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174931
VALIDATED
GPATCH11 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 11
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-258s21c1
Sequence:CCGGAGCAACAGGAAGCCAATTTGACTCGAGTCAAATTGGCTTCCTGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-574s21c1
Sequence:CCGGACAGTTTCGAATGCGACTTAACTCGAGTTAAGTCGCATTCGAAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-913s21c1
Sequence:CCGGAGATCATGACTAAGATTATTCCTCGAGGAATAATCTTAGTCATGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-473s21c1
Sequence:CCGGATTGGTCATGAGGCATCATTACTCGAGTAATGATGCCTCATGACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-436s1c1
Sequence:CCGGGAGTGAAGATTTAAGCGTACTCTCGAGAGTACGCTTAAATCTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-272s1c1
Sequence:CCGGGAAATGAAGCTAGAAGGAGATCTCGAGATCTCCTTCTAGCTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174931.1-265s1c1
Sequence:CCGGGCAAGATGAAATGAAGCTAGACTCGAGTCTAGCTTCATTTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174931.1-317s1c1
Sequence:CCGGCAACAACTGGATGTCCAGAAACTCGAGTTTCTGGACATCCAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174931.1-380s1c1
Sequence:CCGGGAAGAGGAGACTGAAGAAGATCTCGAGATCTTCTTCAGTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174931.1-552s1c1
Sequence:CCGGCAAATTGTCCAGGACCAACTTCTCGAGAAGTTGGTCCTGGACAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174931.1-383s1c1
Sequence:CCGGGAGGAGACTGAAGAAGATGAACTCGAGTTCATCTTCTTCAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-542s1c1
Sequence:CCGGGACCTATCTTCAAATTGTCCACTCGAGTGGACAATTTGAAGATAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-386s1c1
Sequence:CCGGGAGACTGAAGAAGATGAAGAACTCGAGTTCTTCATCTTCTTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174931
VALIDATED
GPATCH11 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 11
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-258s21c1
Sequence:CCGGAGCAACAGGAAGCCAATTTGACTCGAGTCAAATTGGCTTCCTGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-574s21c1
Sequence:CCGGACAGTTTCGAATGCGACTTAACTCGAGTTAAGTCGCATTCGAAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-913s21c1
Sequence:CCGGAGATCATGACTAAGATTATTCCTCGAGGAATAATCTTAGTCATGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-473s21c1
Sequence:CCGGATTGGTCATGAGGCATCATTACTCGAGTAATGATGCCTCATGACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-436s1c1
Sequence:CCGGGAGTGAAGATTTAAGCGTACTCTCGAGAGTACGCTTAAATCTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-272s1c1
Sequence:CCGGGAAATGAAGCTAGAAGGAGATCTCGAGATCTCCTTCTAGCTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174931.1-265s1c1
Sequence:CCGGGCAAGATGAAATGAAGCTAGACTCGAGTCTAGCTTCATTTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174931.1-317s1c1
Sequence:CCGGCAACAACTGGATGTCCAGAAACTCGAGTTTCTGGACATCCAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174931.1-380s1c1
Sequence:CCGGGAAGAGGAGACTGAAGAAGATCTCGAGATCTTCTTCAGTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174931.1-552s1c1
Sequence:CCGGCAAATTGTCCAGGACCAACTTCTCGAGAAGTTGGTCCTGGACAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174931.1-383s1c1
Sequence:CCGGGAGGAGACTGAAGAAGATGAACTCGAGTTCATCTTCTTCAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-542s1c1
Sequence:CCGGGACCTATCTTCAAATTGTCCACTCGAGTGGACAATTTGAAGATAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-386s1c1
Sequence:CCGGGAGACTGAAGAAGATGAAGAACTCGAGTTCTTCATCTTCTTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174931
VALIDATED
GPATCH11 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 11
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-258s21c1
Sequence:CCGGAGCAACAGGAAGCCAATTTGACTCGAGTCAAATTGGCTTCCTGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-574s21c1
Sequence:CCGGACAGTTTCGAATGCGACTTAACTCGAGTTAAGTCGCATTCGAAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-913s21c1
Sequence:CCGGAGATCATGACTAAGATTATTCCTCGAGGAATAATCTTAGTCATGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174931.2-473s21c1
Sequence:CCGGATTGGTCATGAGGCATCATTACTCGAGTAATGATGCCTCATGACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-436s1c1
Sequence:CCGGGAGTGAAGATTTAAGCGTACTCTCGAGAGTACGCTTAAATCTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-272s1c1
Sequence:CCGGGAAATGAAGCTAGAAGGAGATCTCGAGATCTCCTTCTAGCTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174931.1-265s1c1
Sequence:CCGGGCAAGATGAAATGAAGCTAGACTCGAGTCTAGCTTCATTTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174931.1-317s1c1
Sequence:CCGGCAACAACTGGATGTCCAGAAACTCGAGTTTCTGGACATCCAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174931.1-380s1c1
Sequence:CCGGGAAGAGGAGACTGAAGAAGATCTCGAGATCTTCTTCAGTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174931.1-552s1c1
Sequence:CCGGCAAATTGTCCAGGACCAACTTCTCGAGAAGTTGGTCCTGGACAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174931.1-383s1c1
Sequence:CCGGGAGGAGACTGAAGAAGATGAACTCGAGTTCATCTTCTTCAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-542s1c1
Sequence:CCGGGACCTATCTTCAAATTGTCCACTCGAGTGGACAATTTGAAGATAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_174931.1-386s1c1
Sequence:CCGGGAGACTGAAGAAGATGAAGAACTCGAGTTCTTCATCTTCTTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181649
GPATCH11 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 11
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181649.6-1325s21c1
Sequence:CCGGCCCTCCTTACTTTGGATAAATCTCGAGATTTATCCAAAGTAAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181649.6-1278s21c1
Sequence:CCGGGTGACGTTTGTCCAGTTTAAGCTCGAGCTTAAACTGGACAAACGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181649.5-737s1c1
Sequence:CCGGGAAGAGTAAGCAGGATGAAATCTCGAGATTTCATCCTGCTTACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181649.5-2415s1c1
Sequence:CCGGCTACACTACAGTTAGGATTAACTCGAGTTAATCCTAACTGTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181649.5-1498s1c1
Sequence:CCGGCAAACTACCTAAGAGTAATTTCTCGAGAAATTACTCTTAGGTAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181649.6-1106s21c1
Sequence:CCGGCCCAATAAAGGGAAATCATTTCTCGAGAAATGATTTCCCTTTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181649.6-643s21c1
Sequence:CCGGATAGGTCATGAGTCATCATTACTCGAGTAATGATGACTCATGACCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181649.1-287s1c1
Sequence:CCGGGAGATGGTATTGTTGAACCAACTCGAGTTGGTTCAACAATACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181649.1-298s1c1
Sequence:CCGGGTTGAACCAATTCCTCTCAATCTCGAGATTGAGAGGAATTGGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-289s1c1
Sequence:CCGGGATGGTATTGTTGAACCAATTCTCGAGAATTGGTTCAACAATACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-282s1c1
Sequence:CCGGGAGCGGAGATGGTATTGTTGACTCGAGTCAACAATACCATCTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-146s1c1
Sequence:CCGGGAAACAGGCAGAAGAGCGTAACTCGAGTTACGCTCTTCTGCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-187s1c1
Sequence:CCGGCGTGACATCGGGTTGAAGAATCTCGAGATTCTTCAACCCGATGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-304s1c1
Sequence:CCGGCCAATTCCTCTCAATGTCAAACTCGAGTTTGACATTGAGAGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181649
GPATCH11 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 11
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181649.6-1325s21c1
Sequence:CCGGCCCTCCTTACTTTGGATAAATCTCGAGATTTATCCAAAGTAAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181649.6-1278s21c1
Sequence:CCGGGTGACGTTTGTCCAGTTTAAGCTCGAGCTTAAACTGGACAAACGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181649.5-737s1c1
Sequence:CCGGGAAGAGTAAGCAGGATGAAATCTCGAGATTTCATCCTGCTTACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181649.5-2415s1c1
Sequence:CCGGCTACACTACAGTTAGGATTAACTCGAGTTAATCCTAACTGTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181649.5-1498s1c1
Sequence:CCGGCAAACTACCTAAGAGTAATTTCTCGAGAAATTACTCTTAGGTAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181649.6-1106s21c1
Sequence:CCGGCCCAATAAAGGGAAATCATTTCTCGAGAAATGATTTCCCTTTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181649.6-643s21c1
Sequence:CCGGATAGGTCATGAGTCATCATTACTCGAGTAATGATGACTCATGACCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181649.1-287s1c1
Sequence:CCGGGAGATGGTATTGTTGAACCAACTCGAGTTGGTTCAACAATACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181649.1-298s1c1
Sequence:CCGGGTTGAACCAATTCCTCTCAATCTCGAGATTGAGAGGAATTGGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-289s1c1
Sequence:CCGGGATGGTATTGTTGAACCAATTCTCGAGAATTGGTTCAACAATACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-282s1c1
Sequence:CCGGGAGCGGAGATGGTATTGTTGACTCGAGTCAACAATACCATCTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-146s1c1
Sequence:CCGGGAAACAGGCAGAAGAGCGTAACTCGAGTTACGCTCTTCTGCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-187s1c1
Sequence:CCGGCGTGACATCGGGTTGAAGAATCTCGAGATTCTTCAACCCGATGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-304s1c1
Sequence:CCGGCCAATTCCTCTCAATGTCAAACTCGAGTTTGACATTGAGAGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181649
GPATCH11 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 11
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181649.6-1325s21c1
Sequence:CCGGCCCTCCTTACTTTGGATAAATCTCGAGATTTATCCAAAGTAAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181649.6-1278s21c1
Sequence:CCGGGTGACGTTTGTCCAGTTTAAGCTCGAGCTTAAACTGGACAAACGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181649.5-737s1c1
Sequence:CCGGGAAGAGTAAGCAGGATGAAATCTCGAGATTTCATCCTGCTTACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181649.5-2415s1c1
Sequence:CCGGCTACACTACAGTTAGGATTAACTCGAGTTAATCCTAACTGTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181649.5-1498s1c1
Sequence:CCGGCAAACTACCTAAGAGTAATTTCTCGAGAAATTACTCTTAGGTAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181649.6-1106s21c1
Sequence:CCGGCCCAATAAAGGGAAATCATTTCTCGAGAAATGATTTCCCTTTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181649.6-643s21c1
Sequence:CCGGATAGGTCATGAGTCATCATTACTCGAGTAATGATGACTCATGACCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181649.1-287s1c1
Sequence:CCGGGAGATGGTATTGTTGAACCAACTCGAGTTGGTTCAACAATACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181649.1-298s1c1
Sequence:CCGGGTTGAACCAATTCCTCTCAATCTCGAGATTGAGAGGAATTGGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-289s1c1
Sequence:CCGGGATGGTATTGTTGAACCAATTCTCGAGAATTGGTTCAACAATACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-282s1c1
Sequence:CCGGGAGCGGAGATGGTATTGTTGACTCGAGTCAACAATACCATCTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-146s1c1
Sequence:CCGGGAAACAGGCAGAAGAGCGTAACTCGAGTTACGCTCTTCTGCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-187s1c1
Sequence:CCGGCGTGACATCGGGTTGAAGAATCTCGAGATTCTTCAACCCGATGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181649.1-304s1c1
Sequence:CCGGCCAATTCCTCTCAATGTCAAACTCGAGTTTGACATTGAGAGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks