EMAIL THIS PAGE TO A FRIEND

GPATCH1

G patch domain containing 1

63 Gene Product Result for
Synonyms: ECGP GPATC1
UniProtKB ID: Q9BRR8, Q8IZV6, Q8N3B7, Q9NW94
Gene ID:
Mouse(67471) G patch domain containing 1
Rat(292810) G patch domain containing 1
Zebrafish(448925) G patch domain containing 1
cow(518738) G patch domain containing 1
domestic cat(101091325) G patch domain containing 1
dog(476495) G patch domain containing 1
chicken(415772) G patch domain containing 1
naked mole-rat(101726498) G patch domain containing 1
sheep(101117528) G patch domain containing 1
Domestic Rabbit(100337718) G patch domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018025 Rosetta Predictions human pricing
NM_001106246 Rosetta Predictions rat pricing
NM_026181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068969 predicted 2236
2 SASI_Hs01_00068970 predicted 1476
3 SASI_Hs01_00068971 predicted 1415
4 SASI_Hs01_00068972 predicted 2637
5 SASI_Hs01_00068973 predicted 491
6 SASI_Hs01_00068974 predicted 624
7 SASI_Hs01_00068975 predicted 635
8 SASI_Hs01_00068976 predicted 1227
9 SASI_Hs01_00068977 predicted 2569
10 SASI_Hs01_00068978 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217078 predicted 2213
2 SASI_Rn02_00217079 predicted 860
3 SASI_Rn02_00217080 predicted 1188
4 SASI_Rn02_00217081 predicted 346
5 SASI_Rn02_00217082 predicted 2091
6 SASI_Rn02_00217083 predicted 1032
7 SASI_Rn02_00217084 predicted 327
8 SASI_Rn02_00217085 predicted 1954
9 SASI_Rn02_00217086 predicted 944
10 SASI_Rn02_00217087 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069178 predicted 1318
2 SASI_Mm01_00069179 predicted 265
3 SASI_Mm01_00069180 predicted 1750
4 SASI_Mm01_00069181 predicted 1906
5 SASI_Mm01_00069182 predicted 346
6 SASI_Mm01_00069183 predicted 322
7 SASI_Mm01_00069184 predicted 2088
8 SASI_Mm01_00069185 predicted 1035
9 SASI_Mm01_00069186 predicted 1690
10 SASI_Mm01_00069187 predicted 1183
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018025
VALIDATED
GPATCH1 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-3161s1c1
Sequence:CCGGGCCCAGTGATTGTTCAGTTAACTCGAGTTAACTGAACAATCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-1107s1c1
Sequence:CCGGGCTGGCGATCTTGGAGAAATTCTCGAGAATTTCTCCAAGATCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018025.2-2196s1c1
Sequence:CCGGCCTTATCCAGATTCAACTTTACTCGAGTAAAGTTGAATCTGGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-2487s1c1
Sequence:CCGGGCACCAGAATTATCCGCAAATCTCGAGATTTGCGGATAATTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-1588s1c1
Sequence:CCGGCGCCTATTCAAGGTTCAGCTACTCGAGTAGCTGAACCTTGAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018025.2-1477s21c1
Sequence:CCGGCACACTTACTGCAGGTATTATCTCGAGATAATACCTGCAGTAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018025.2-771s21c1
Sequence:CCGGTTATCTGTTGGTTTCGAATTGCTCGAGCAATTCGAAACCAACAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018025.2-1284s21c1
Sequence:CCGGACAGCACCCAGGCAGTATAAACTCGAGTTTATACTGCCTGGGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018025
VALIDATED
GPATCH1 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-3161s1c1
Sequence:CCGGGCCCAGTGATTGTTCAGTTAACTCGAGTTAACTGAACAATCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-1107s1c1
Sequence:CCGGGCTGGCGATCTTGGAGAAATTCTCGAGAATTTCTCCAAGATCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018025.2-2196s1c1
Sequence:CCGGCCTTATCCAGATTCAACTTTACTCGAGTAAAGTTGAATCTGGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-2487s1c1
Sequence:CCGGGCACCAGAATTATCCGCAAATCTCGAGATTTGCGGATAATTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-1588s1c1
Sequence:CCGGCGCCTATTCAAGGTTCAGCTACTCGAGTAGCTGAACCTTGAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018025.2-1477s21c1
Sequence:CCGGCACACTTACTGCAGGTATTATCTCGAGATAATACCTGCAGTAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018025.2-771s21c1
Sequence:CCGGTTATCTGTTGGTTTCGAATTGCTCGAGCAATTCGAAACCAACAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018025.2-1284s21c1
Sequence:CCGGACAGCACCCAGGCAGTATAAACTCGAGTTTATACTGCCTGGGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018025
VALIDATED
GPATCH1 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-3161s1c1
Sequence:CCGGGCCCAGTGATTGTTCAGTTAACTCGAGTTAACTGAACAATCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-1107s1c1
Sequence:CCGGGCTGGCGATCTTGGAGAAATTCTCGAGAATTTCTCCAAGATCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018025.2-2196s1c1
Sequence:CCGGCCTTATCCAGATTCAACTTTACTCGAGTAAAGTTGAATCTGGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-2487s1c1
Sequence:CCGGGCACCAGAATTATCCGCAAATCTCGAGATTTGCGGATAATTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018025.2-1588s1c1
Sequence:CCGGCGCCTATTCAAGGTTCAGCTACTCGAGTAGCTGAACCTTGAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018025.2-1477s21c1
Sequence:CCGGCACACTTACTGCAGGTATTATCTCGAGATAATACCTGCAGTAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018025.2-771s21c1
Sequence:CCGGTTATCTGTTGGTTTCGAATTGCTCGAGCAATTCGAAACCAACAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018025.2-1284s21c1
Sequence:CCGGACAGCACCCAGGCAGTATAAACTCGAGTTTATACTGCCTGGGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026181
VALIDATED
GPATCH1 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-2857s1c1
Sequence:CCGGCCTCCATGATGCACATCCATTCTCGAGAATGGATGTGCATCATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026181.1-778s1c1
Sequence:CCGGCCAGGAGAACACCTGAATCTTCTCGAGAAGATTCAGGTGTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-1939s1c1
Sequence:CCGGCCCAGAGTGAAGAGGGATAAACTCGAGTTTATCCCTCTTCACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-1192s1c1
Sequence:CCGGGCTCACGTACTTCAGGTGTTACTCGAGTAACACCTGAAGTACGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-1940s1c1
Sequence:CCGGCCAGAGTGAAGAGGGATAAATCTCGAGATTTATCCCTCTTCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026181
VALIDATED
GPATCH1 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-2857s1c1
Sequence:CCGGCCTCCATGATGCACATCCATTCTCGAGAATGGATGTGCATCATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026181.1-778s1c1
Sequence:CCGGCCAGGAGAACACCTGAATCTTCTCGAGAAGATTCAGGTGTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-1939s1c1
Sequence:CCGGCCCAGAGTGAAGAGGGATAAACTCGAGTTTATCCCTCTTCACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-1192s1c1
Sequence:CCGGGCTCACGTACTTCAGGTGTTACTCGAGTAACACCTGAAGTACGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-1940s1c1
Sequence:CCGGCCAGAGTGAAGAGGGATAAATCTCGAGATTTATCCCTCTTCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026181
VALIDATED
GPATCH1 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-2857s1c1
Sequence:CCGGCCTCCATGATGCACATCCATTCTCGAGAATGGATGTGCATCATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026181.1-778s1c1
Sequence:CCGGCCAGGAGAACACCTGAATCTTCTCGAGAAGATTCAGGTGTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-1939s1c1
Sequence:CCGGCCCAGAGTGAAGAGGGATAAACTCGAGTTTATCCCTCTTCACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-1192s1c1
Sequence:CCGGGCTCACGTACTTCAGGTGTTACTCGAGTAACACCTGAAGTACGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026181.1-1940s1c1
Sequence:CCGGCCAGAGTGAAGAGGGATAAATCTCGAGATTTATCCCTCTTCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks