EMAIL THIS PAGE TO A FRIEND

GPATCH2

G patch domain containing 2

201 Gene Product Result for
Synonyms: CT110 GPATC2 PPP1R30 RP11-361K17.1
UniProtKB ID: Q9NW75, Q5VYK7, Q5VYK8, Q86YE7
Gene ID:
Mouse(67769) G patch domain containing 2
Rat(289362) G patch domain containing 2
Zebrafish(555214) G patch domain containing 2
dog(488594) G patch domain containing 2
cow(540878) G patch domain containing 2
Horse(100050453) G patch domain containing 2
domestic cat(101092484) G patch domain containing 2
chicken(421355) G patch domain containing 2
domestic guinea pig(100718508) G patch domain containing 2
naked mole-rat(101706119) G patch domain containing 2
sheep(101103251) G patch domain containing 2
Domestic Rabbit(100342470) G patch domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018040 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018040 Rosetta Predictions human pricing
NM_001011909 Rosetta Predictions rat pricing
XM_573535 Rosetta Predictions rat pricing
NM_026367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106142 predicted 589
2 SASI_Hs01_00106143 predicted 1056
3 SASI_Hs01_00106144 predicted 1012
4 SASI_Hs01_00106145 predicted 790
5 SASI_Hs01_00106146 predicted 1216
6 SASI_Hs02_00351160 predicted 248
7 SASI_Hs01_00106147 predicted 1709
8 SASI_Hs02_00351161 predicted 907
9 SASI_Hs01_00106149 predicted 1386
10 SASI_Hs01_00106150 predicted 393
11 SASI_Hs01_00106148 predicted 859
12 SASI_Hs01_00106151 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199901 predicted 418
2 SASI_Rn01_00038321 predicted 884
3 SASI_Rn01_00038322 predicted 950
4 SASI_Rn01_00038323 predicted 481
5 SASI_Rn01_00038324 predicted 346
6 SASI_Rn01_00038325 predicted 226
7 SASI_Rn01_00038326 predicted 816
8 SASI_Rn01_00038327 predicted 981
9 SASI_Rn01_00038328 predicted 554
10 SASI_Rn01_00038329 predicted 318
11 SASI_Rn01_00038330 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160091 predicted 710
2 SASI_Rn01_00160092 predicted 504
3 SASI_Rn01_00160093 predicted 518
4 SASI_Rn01_00160094 predicted 372
5 SASI_Rn01_00160095 predicted 448
6 SASI_Rn01_00160096 predicted 379
7 SASI_Rn01_00160097 predicted 255
8 SASI_Rn01_00160098 predicted 252
9 SASI_Rn01_00160099 predicted 502
10 SASI_Rn01_00160100 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036677 predicted 1707
2 SASI_Mm01_00036678 predicted 1669
3 SASI_Mm01_00036679 predicted 356
4 SASI_Mm01_00036680 predicted 1196
5 SASI_Mm01_00036681 predicted 1455
6 SASI_Mm01_00036682 predicted 1125
7 SASI_Mm01_00036683 predicted 423
8 SASI_Mm01_00036684 predicted 793
9 SASI_Mm01_00036685 predicted 1483
10 SASI_Mm02_00330095 predicted 229
11 SASI_Mm01_00036686 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026367
GPATCH2 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026367.3-1793s1c1
Sequence:CCGGCGCCAGTGATAGAAATGGGATCTCGAGATCCCATTTCTATCACTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-135s1c1
Sequence:CCGGGCTGGCATTTCAGTCGAACAACTCGAGTTGTTCGACTGAAATGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-342s1c1
Sequence:CCGGGCTTAAGTGAAGGCTCTGATTCTCGAGAATCAGAGCCTTCACTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-1131s1c1
Sequence:CCGGGAACGCCTTCAAAGAATATTACTCGAGTAATATTCTTTGAAGGCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-1288s1c1
Sequence:CCGGGCATCAGCTTCTGAGAGATAACTCGAGTTATCTCTCAGAAGCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-230s21c1
Sequence:CCGGACTGGAGAACATTCTCGAAATCTCGAGATTTCGAGAATGTTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-1239s21c1
Sequence:CCGGATCGCCATGACCACTGGTTTACTCGAGTAAACCAGTGGTCATGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-294s21c1
Sequence:CCGGGGAAGCGGAGATCCTACAATGCTCGAGCATTGTAGGATCTCCGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026367.3-2309s21c1
Sequence:CCGGGGACGTAAAGTCATCGCTAAACTCGAGTTTAGCGATGACTTTACGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-1131s21c1
Sequence:CCGGGAACGCCTTCAAAGAATATTACTCGAGTAATATTCTTTGAAGGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026367
GPATCH2 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026367.3-1793s1c1
Sequence:CCGGCGCCAGTGATAGAAATGGGATCTCGAGATCCCATTTCTATCACTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-135s1c1
Sequence:CCGGGCTGGCATTTCAGTCGAACAACTCGAGTTGTTCGACTGAAATGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-342s1c1
Sequence:CCGGGCTTAAGTGAAGGCTCTGATTCTCGAGAATCAGAGCCTTCACTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-1131s1c1
Sequence:CCGGGAACGCCTTCAAAGAATATTACTCGAGTAATATTCTTTGAAGGCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-1288s1c1
Sequence:CCGGGCATCAGCTTCTGAGAGATAACTCGAGTTATCTCTCAGAAGCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-230s21c1
Sequence:CCGGACTGGAGAACATTCTCGAAATCTCGAGATTTCGAGAATGTTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-1239s21c1
Sequence:CCGGATCGCCATGACCACTGGTTTACTCGAGTAAACCAGTGGTCATGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-294s21c1
Sequence:CCGGGGAAGCGGAGATCCTACAATGCTCGAGCATTGTAGGATCTCCGCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026367.3-2309s21c1
Sequence:CCGGGGACGTAAAGTCATCGCTAAACTCGAGTTTAGCGATGACTTTACGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-1131s21c1
Sequence:CCGGGAACGCCTTCAAAGAATATTACTCGAGTAATATTCTTTGAAGGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026367
GPATCH2 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026367.3-1793s1c1
Sequence:CCGGCGCCAGTGATAGAAATGGGATCTCGAGATCCCATTTCTATCACTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-135s1c1
Sequence:CCGGGCTGGCATTTCAGTCGAACAACTCGAGTTGTTCGACTGAAATGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-342s1c1
Sequence:CCGGGCTTAAGTGAAGGCTCTGATTCTCGAGAATCAGAGCCTTCACTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-1131s1c1
Sequence:CCGGGAACGCCTTCAAAGAATATTACTCGAGTAATATTCTTTGAAGGCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026367.3-1288s1c1
Sequence:CCGGGCATCAGCTTCTGAGAGATAACTCGAGTTATCTCTCAGAAGCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-230s21c1
Sequence:CCGGACTGGAGAACATTCTCGAAATCTCGAGATTTCGAGAATGTTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-1239s21c1
Sequence:CCGGATCGCCATGACCACTGGTTTACTCGAGTAAACCAGTGGTCATGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-294s21c1
Sequence:CCGGGGAAGCGGAGATCCTACAATGCTCGAGCATTGTAGGATCTCCGCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026367.3-2309s21c1
Sequence:CCGGGGACGTAAAGTCATCGCTAAACTCGAGTTTAGCGATGACTTTACGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026367.3-1131s21c1
Sequence:CCGGGAACGCCTTCAAAGAATATTACTCGAGTAATATTCTTTGAAGGCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018040
VALIDATED
GPATCH2 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 2
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018040.1-1185s1c1
Sequence:CCGGCCAACTTCAATGGTACCCATTCTCGAGAATGGGTACCATTGAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018040.1-1979s1c1
Sequence:CCGGCCGATGCTTTGCTTAATTCATCTCGAGATGAATTAAGCAAAGCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018040.1-1305s1c1
Sequence:CCGGCATCAGCTTCTGAGAGATAATCTCGAGATTATCTCTCAGAAGCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018040.1-250s1c1
Sequence:CCGGGAGACCATTCTCGAAGTATATCTCGAGATATACTTCGAGAATGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134117    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018040.1-2140s1c1
Sequence:CCGGCCGAACACATCTTTGTTTGAACTCGAGTTCAAACAAAGATGTGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018040.1-1933s1c1
Sequence:CCGGGCAGCTCGTTTCTCTTATTTACTCGAGTAAATAAGAGAAACGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018040.1-892s1c1
Sequence:CCGGGCACTGATGCTGGATTGTTTACTCGAGTAAACAATCCAGCATCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-1218s21c1
Sequence:CCGGTAACAAGAGAATGGTTCATTTCTCGAGAAATGAACCATTCTCTTGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-796s21c1
Sequence:CCGGGAAACGAACCAGACCAATAAGCTCGAGCTTATTGGTCTGGTTCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-401s21c1
Sequence:CCGGACTATAGAGAGAATCACAATACTCGAGTATTGTGATTCTCTCTATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-1382s21c1
Sequence:CCGGGCATGCATTTAGGATCCTTATCTCGAGATAAGGATCCTAAATGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-680s21c1
Sequence:CCGGGTGATAGAGCCTACCAGTATCCTCGAGGATACTGGTAGGCTCTATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-357s21c1
Sequence:CCGGCTTAAGTGAAGGCTCTGATTCCTCGAGGAATCAGAGCCTTCACTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018040.2-1720s21c1
Sequence:CCGGACTATGTCCCATTGTTCTAAACTCGAGTTTAGAACAATGGGACATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-543s21c1
Sequence:CCGGTGTGGACAATGTTGGGAATAGCTCGAGCTATTCCCAACATTGTCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-1051s21c1
Sequence:CCGGGATCCTGTCTTTGAAAGTATCCTCGAGGATACTTTCAAAGACAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-619s21c1
Sequence:CCGGATCTCTAACAAACGGACAATGCTCGAGCATTGTCCGTTTGTTAGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018040.2-2035s21c1
Sequence:CCGGGCACACCCACCAGTTTCTAAACTCGAGTTTAGAAACTGGTGGGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018040
VALIDATED
GPATCH2 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 2
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018040.1-1185s1c1
Sequence:CCGGCCAACTTCAATGGTACCCATTCTCGAGAATGGGTACCATTGAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018040.1-1979s1c1
Sequence:CCGGCCGATGCTTTGCTTAATTCATCTCGAGATGAATTAAGCAAAGCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018040.1-1305s1c1
Sequence:CCGGCATCAGCTTCTGAGAGATAATCTCGAGATTATCTCTCAGAAGCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018040.1-250s1c1
Sequence:CCGGGAGACCATTCTCGAAGTATATCTCGAGATATACTTCGAGAATGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134117    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018040.1-2140s1c1
Sequence:CCGGCCGAACACATCTTTGTTTGAACTCGAGTTCAAACAAAGATGTGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018040.1-1933s1c1
Sequence:CCGGGCAGCTCGTTTCTCTTATTTACTCGAGTAAATAAGAGAAACGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018040.1-892s1c1
Sequence:CCGGGCACTGATGCTGGATTGTTTACTCGAGTAAACAATCCAGCATCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-1218s21c1
Sequence:CCGGTAACAAGAGAATGGTTCATTTCTCGAGAAATGAACCATTCTCTTGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-796s21c1
Sequence:CCGGGAAACGAACCAGACCAATAAGCTCGAGCTTATTGGTCTGGTTCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-401s21c1
Sequence:CCGGACTATAGAGAGAATCACAATACTCGAGTATTGTGATTCTCTCTATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-1382s21c1
Sequence:CCGGGCATGCATTTAGGATCCTTATCTCGAGATAAGGATCCTAAATGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-680s21c1
Sequence:CCGGGTGATAGAGCCTACCAGTATCCTCGAGGATACTGGTAGGCTCTATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-357s21c1
Sequence:CCGGCTTAAGTGAAGGCTCTGATTCCTCGAGGAATCAGAGCCTTCACTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018040.2-1720s21c1
Sequence:CCGGACTATGTCCCATTGTTCTAAACTCGAGTTTAGAACAATGGGACATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-543s21c1
Sequence:CCGGTGTGGACAATGTTGGGAATAGCTCGAGCTATTCCCAACATTGTCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-1051s21c1
Sequence:CCGGGATCCTGTCTTTGAAAGTATCCTCGAGGATACTTTCAAAGACAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-619s21c1
Sequence:CCGGATCTCTAACAAACGGACAATGCTCGAGCATTGTCCGTTTGTTAGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018040.2-2035s21c1
Sequence:CCGGGCACACCCACCAGTTTCTAAACTCGAGTTTAGAAACTGGTGGGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018040
VALIDATED
GPATCH2 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 2
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018040.1-1185s1c1
Sequence:CCGGCCAACTTCAATGGTACCCATTCTCGAGAATGGGTACCATTGAAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018040.1-1979s1c1
Sequence:CCGGCCGATGCTTTGCTTAATTCATCTCGAGATGAATTAAGCAAAGCATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018040.1-1305s1c1
Sequence:CCGGCATCAGCTTCTGAGAGATAATCTCGAGATTATCTCTCAGAAGCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018040.1-250s1c1
Sequence:CCGGGAGACCATTCTCGAAGTATATCTCGAGATATACTTCGAGAATGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134117    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018040.1-2140s1c1
Sequence:CCGGCCGAACACATCTTTGTTTGAACTCGAGTTCAAACAAAGATGTGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018040.1-1933s1c1
Sequence:CCGGGCAGCTCGTTTCTCTTATTTACTCGAGTAAATAAGAGAAACGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018040.1-892s1c1
Sequence:CCGGGCACTGATGCTGGATTGTTTACTCGAGTAAACAATCCAGCATCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-1218s21c1
Sequence:CCGGTAACAAGAGAATGGTTCATTTCTCGAGAAATGAACCATTCTCTTGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-796s21c1
Sequence:CCGGGAAACGAACCAGACCAATAAGCTCGAGCTTATTGGTCTGGTTCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-401s21c1
Sequence:CCGGACTATAGAGAGAATCACAATACTCGAGTATTGTGATTCTCTCTATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-1382s21c1
Sequence:CCGGGCATGCATTTAGGATCCTTATCTCGAGATAAGGATCCTAAATGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-680s21c1
Sequence:CCGGGTGATAGAGCCTACCAGTATCCTCGAGGATACTGGTAGGCTCTATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-357s21c1
Sequence:CCGGCTTAAGTGAAGGCTCTGATTCCTCGAGGAATCAGAGCCTTCACTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018040.2-1720s21c1
Sequence:CCGGACTATGTCCCATTGTTCTAAACTCGAGTTTAGAACAATGGGACATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-543s21c1
Sequence:CCGGTGTGGACAATGTTGGGAATAGCTCGAGCTATTCCCAACATTGTCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-1051s21c1
Sequence:CCGGGATCCTGTCTTTGAAAGTATCCTCGAGGATACTTTCAAAGACAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018040.2-619s21c1
Sequence:CCGGATCTCTAACAAACGGACAATGCTCGAGCATTGTCCGTTTGTTAGAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018040.2-2035s21c1
Sequence:CCGGGCACACCCACCAGTTTCTAAACTCGAGTTTAGAAACTGGTGGGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)