EMAIL THIS PAGE TO A FRIEND

GPATCH2L

G patch domain containing 2-like

121 Gene Product Result for
Synonyms: C14orf118
UniProtKB ID: Q9NWQ4, B3KN42, Q6PEJ7, Q9H3M3, Q9NWH0, Q9ULR8
Gene ID:
Mouse(70373) G patch domain containing 2 like
Rat(314325) G patch domain containing 2-like
sheep(101112322) G patch domain containing 2-like
domestic guinea pig(100715994) G patch domain containing 2-like
naked mole-rat(101711467) G patch domain containing 2-like
domestic cat(101098961) G patch domain containing 2-like
cow(509393) G patch domain containing 2-like
dog(480397) G patch domain containing 2-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017926 Rosetta Predictions human pricing
NM_017972 Rosetta Predictions human pricing
NM_001134559 Rosetta Predictions rat pricing
NM_027405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065370 predicted 631
2 SASI_Hs02_00350928 predicted 681
3 SASI_Hs01_00065371 predicted 300
4 SASI_Hs01_00065372 predicted 417
5 SASI_Hs01_00065373 predicted 387
6 SASI_Hs01_00065374 predicted 854
7 SASI_Hs01_00065375 predicted 825
8 SASI_Hs01_00065376 predicted 844
9 SASI_Hs01_00065378 predicted 841
10 SASI_Hs01_00065379 predicted 858
11 SASI_Hs01_00065377 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351009 predicted 625
2 SASI_Hs02_00351010 predicted 679
3 SASI_Hs01_00165181 predicted 299
4 SASI_Hs01_00165182 predicted 417
5 SASI_Hs01_00165183 predicted 388
6 SASI_Hs01_00165184 predicted 849
7 SASI_Hs01_00165185 predicted 826
8 SASI_Hs01_00165186 predicted 843
9 SASI_Hs01_00165188 predicted 847
10 SASI_Hs01_00165189 predicted 852
11 SASI_Hs01_00165187 predicted 729
12 SASI_Hs01_00165190 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257079 predicted 645
2 SASI_Rn02_00257080 predicted 1181
3 SASI_Rn02_00257081 predicted 411
4 SASI_Rn02_00257082 predicted 512
5 SASI_Rn02_00257083 predicted 640
6 SASI_Rn02_00257084 predicted 1953
7 SASI_Rn02_00257085 predicted 1993
8 SASI_Rn02_00257086 predicted 852
9 SASI_Rn02_00257087 predicted 927
10 SASI_Rn02_00257088 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332128 predicted 637
2 SASI_Mm01_00157161 predicted 1506
3 SASI_Mm01_00157162 predicted 1178
4 SASI_Mm01_00157163 predicted 507
5 SASI_Mm01_00157164 predicted 1289
6 SASI_Mm01_00157165 predicted 1161
7 SASI_Mm01_00157166 predicted 633
8 SASI_Mm01_00157167 predicted 1135
9 SASI_Mm01_00157168 predicted 1567
10 SASI_Mm01_00157169 predicted 1540
11 SASI_Mm01_00157170 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017926
VALIDATED
GPATCH2L MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 2-like
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017926.2-1602s21c1
Sequence:CCGGGATAGTCTTGCATATCTTAATCTCGAGATTAAGATATGCAAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-418s21c1
Sequence:CCGGGGCATGAATCTGACTCCTTTACTCGAGTAAAGGAGTCAGATTCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-1145s21c1
Sequence:CCGGTAAAGCGTTGGCTTCTGATTTCTCGAGAAATCAGAAGCCAACGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-926s21c1
Sequence:CCGGGGATTCTGGATTGGATAAATTCTCGAGAATTTATCCAATCCAGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-1476s21c1
Sequence:CCGGGACGCAACTACTGCTACATTTCTCGAGAAATGTAGCAGTAGTTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-519s1c1
Sequence:CCGGCAGAAGCTGAAGGTGTCAGATCTCGAGATCTGACACCTTCAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017926.2-2128s1c1
Sequence:CCGGGCAGAAACTCAGACAGCTCATCTCGAGATGAGCTGTCTGAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137647    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-2003s1c1
Sequence:CCGGCTTGCCTTTGAGCCTACTCTTCTCGAGAAGAGTAGGCTCAAAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-560s1c1
Sequence:CCGGCAGGTTCAAGTCTGCTAAGAACTCGAGTTCTTAGCAGACTTGAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-1818s1c1
Sequence:CCGGCCATTTACAGAACTGTTGCTTCTCGAGAAGCAACAGTTCTGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017926.2-897s1c1
Sequence:CCGGCCTGATCATTGTTCTGAAGTACTCGAGTACTTCAGAACAATGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-1843s1c1
Sequence:CCGGGCAGTTGTCTTTGTTCTTGAACTCGAGTTCAAGAACAAAGACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-696s1c1
Sequence:CCGGGAGTGTGAAACAGATGAACAACTCGAGTTGTTCATCTGTTTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017926.2-1575s1c1
Sequence:CCGGCTGAAGCAAATGTTGGACTTTCTCGAGAAAGTCCAACATTTGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137244    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-1574s1c1
Sequence:CCGGGCTGAAGCAAATGTTGGACTTCTCGAGAAGTCCAACATTTGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017926.2-125s1c1
Sequence:CCGGGCAGACATCTGAGCAGAATAACTCGAGTTATTCTGCTCAGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-351s1c1
Sequence:CCGGGATGACACAATGGTAGCCAAACTCGAGTTTGGCTACCATTGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-1179s1c1
Sequence:CCGGGCTTGTGCACATGAGTTCAATCTCGAGATTGAACTCATGTGCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017926.2-390s1c1
Sequence:CCGGGCCATTGTCAAGAGTAAGCAACTCGAGTTGCTTACTCTTGACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017926
VALIDATED
GPATCH2L MISSION shRNA shRNA Plasmid DNA
G patch domain containing 2-like
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017926.2-1602s21c1
Sequence:CCGGGATAGTCTTGCATATCTTAATCTCGAGATTAAGATATGCAAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-418s21c1
Sequence:CCGGGGCATGAATCTGACTCCTTTACTCGAGTAAAGGAGTCAGATTCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-1145s21c1
Sequence:CCGGTAAAGCGTTGGCTTCTGATTTCTCGAGAAATCAGAAGCCAACGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-926s21c1
Sequence:CCGGGGATTCTGGATTGGATAAATTCTCGAGAATTTATCCAATCCAGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-1476s21c1
Sequence:CCGGGACGCAACTACTGCTACATTTCTCGAGAAATGTAGCAGTAGTTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-519s1c1
Sequence:CCGGCAGAAGCTGAAGGTGTCAGATCTCGAGATCTGACACCTTCAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017926.2-2128s1c1
Sequence:CCGGGCAGAAACTCAGACAGCTCATCTCGAGATGAGCTGTCTGAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137647    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-2003s1c1
Sequence:CCGGCTTGCCTTTGAGCCTACTCTTCTCGAGAAGAGTAGGCTCAAAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-560s1c1
Sequence:CCGGCAGGTTCAAGTCTGCTAAGAACTCGAGTTCTTAGCAGACTTGAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-1818s1c1
Sequence:CCGGCCATTTACAGAACTGTTGCTTCTCGAGAAGCAACAGTTCTGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017926.2-897s1c1
Sequence:CCGGCCTGATCATTGTTCTGAAGTACTCGAGTACTTCAGAACAATGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-1843s1c1
Sequence:CCGGGCAGTTGTCTTTGTTCTTGAACTCGAGTTCAAGAACAAAGACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-696s1c1
Sequence:CCGGGAGTGTGAAACAGATGAACAACTCGAGTTGTTCATCTGTTTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017926.2-1575s1c1
Sequence:CCGGCTGAAGCAAATGTTGGACTTTCTCGAGAAAGTCCAACATTTGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137244    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-1574s1c1
Sequence:CCGGGCTGAAGCAAATGTTGGACTTCTCGAGAAGTCCAACATTTGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017926.2-125s1c1
Sequence:CCGGGCAGACATCTGAGCAGAATAACTCGAGTTATTCTGCTCAGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-351s1c1
Sequence:CCGGGATGACACAATGGTAGCCAAACTCGAGTTTGGCTACCATTGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-1179s1c1
Sequence:CCGGGCTTGTGCACATGAGTTCAATCTCGAGATTGAACTCATGTGCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017926.2-390s1c1
Sequence:CCGGGCCATTGTCAAGAGTAAGCAACTCGAGTTGCTTACTCTTGACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017926
VALIDATED
GPATCH2L MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 2-like
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017926.2-1602s21c1
Sequence:CCGGGATAGTCTTGCATATCTTAATCTCGAGATTAAGATATGCAAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-418s21c1
Sequence:CCGGGGCATGAATCTGACTCCTTTACTCGAGTAAAGGAGTCAGATTCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-1145s21c1
Sequence:CCGGTAAAGCGTTGGCTTCTGATTTCTCGAGAAATCAGAAGCCAACGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-926s21c1
Sequence:CCGGGGATTCTGGATTGGATAAATTCTCGAGAATTTATCCAATCCAGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017926.2-1476s21c1
Sequence:CCGGGACGCAACTACTGCTACATTTCTCGAGAAATGTAGCAGTAGTTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-519s1c1
Sequence:CCGGCAGAAGCTGAAGGTGTCAGATCTCGAGATCTGACACCTTCAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017926.2-2128s1c1
Sequence:CCGGGCAGAAACTCAGACAGCTCATCTCGAGATGAGCTGTCTGAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137647    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-2003s1c1
Sequence:CCGGCTTGCCTTTGAGCCTACTCTTCTCGAGAAGAGTAGGCTCAAAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-560s1c1
Sequence:CCGGCAGGTTCAAGTCTGCTAAGAACTCGAGTTCTTAGCAGACTTGAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-1818s1c1
Sequence:CCGGCCATTTACAGAACTGTTGCTTCTCGAGAAGCAACAGTTCTGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017926.2-897s1c1
Sequence:CCGGCCTGATCATTGTTCTGAAGTACTCGAGTACTTCAGAACAATGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-1843s1c1
Sequence:CCGGGCAGTTGTCTTTGTTCTTGAACTCGAGTTCAAGAACAAAGACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-696s1c1
Sequence:CCGGGAGTGTGAAACAGATGAACAACTCGAGTTGTTCATCTGTTTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017926.2-1575s1c1
Sequence:CCGGCTGAAGCAAATGTTGGACTTTCTCGAGAAAGTCCAACATTTGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137244    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017926.2-1574s1c1
Sequence:CCGGGCTGAAGCAAATGTTGGACTTCTCGAGAAGTCCAACATTTGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017926.2-125s1c1
Sequence:CCGGGCAGACATCTGAGCAGAATAACTCGAGTTATTCTGCTCAGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-351s1c1
Sequence:CCGGGATGACACAATGGTAGCCAAACTCGAGTTTGGCTACCATTGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017926.2-1179s1c1
Sequence:CCGGGCTTGTGCACATGAGTTCAATCTCGAGATTGAACTCATGTGCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017926.2-390s1c1
Sequence:CCGGGCCATTGTCAAGAGTAAGCAACTCGAGTTGCTTACTCTTGACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027405
VALIDATED
GPATCH2L MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 2-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-563s21c1
Sequence:CCGGTGCCAAGAAGCAGCGTCTATCCTCGAGGATAGACGCTGCTTCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-982s21c1
Sequence:CCGGGATACCATGGTCGTCTGAATACTCGAGTATTCAGACGACCATGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027405.2-3540s21c1
Sequence:CCGGACTACAGCATCTACCTATAATCTCGAGATTATAGGTAGATGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-1155s21c1
Sequence:CCGGAGAGAACGGAATCAGTTTAATCTCGAGATTAAACTGATTCCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-849s21c1
Sequence:CCGGCCCGGATTCACTGTCCATAACCTCGAGGTTATGGACAGTGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027405.2-652s1c1
Sequence:CCGGCTTTCCTAAGCCAACCAGGAACTCGAGTTCCTGGTTGGCTTAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027405.2-1764s1c1
Sequence:CCGGGCTGTGTCTTTGTTCCTGAAACTCGAGTTTCAGGAACAAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027405.2-518s1c1
Sequence:CCGGGAAAGTGTCAGATTGGAGCTACTCGAGTAGCTCCAATCTGACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027405.2-414s1c1
Sequence:CCGGGAGTCTGACTCCTTTACGGAACTCGAGTTCCGTAAAGGAGTCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027405
VALIDATED
GPATCH2L MISSION shRNA shRNA Plasmid DNA
G patch domain containing 2-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-563s21c1
Sequence:CCGGTGCCAAGAAGCAGCGTCTATCCTCGAGGATAGACGCTGCTTCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-982s21c1
Sequence:CCGGGATACCATGGTCGTCTGAATACTCGAGTATTCAGACGACCATGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027405.2-3540s21c1
Sequence:CCGGACTACAGCATCTACCTATAATCTCGAGATTATAGGTAGATGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-1155s21c1
Sequence:CCGGAGAGAACGGAATCAGTTTAATCTCGAGATTAAACTGATTCCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-849s21c1
Sequence:CCGGCCCGGATTCACTGTCCATAACCTCGAGGTTATGGACAGTGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027405.2-652s1c1
Sequence:CCGGCTTTCCTAAGCCAACCAGGAACTCGAGTTCCTGGTTGGCTTAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027405.2-1764s1c1
Sequence:CCGGGCTGTGTCTTTGTTCCTGAAACTCGAGTTTCAGGAACAAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027405.2-518s1c1
Sequence:CCGGGAAAGTGTCAGATTGGAGCTACTCGAGTAGCTCCAATCTGACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027405.2-414s1c1
Sequence:CCGGGAGTCTGACTCCTTTACGGAACTCGAGTTCCGTAAAGGAGTCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027405
VALIDATED
GPATCH2L MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 2-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-563s21c1
Sequence:CCGGTGCCAAGAAGCAGCGTCTATCCTCGAGGATAGACGCTGCTTCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-982s21c1
Sequence:CCGGGATACCATGGTCGTCTGAATACTCGAGTATTCAGACGACCATGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027405.2-3540s21c1
Sequence:CCGGACTACAGCATCTACCTATAATCTCGAGATTATAGGTAGATGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-1155s21c1
Sequence:CCGGAGAGAACGGAATCAGTTTAATCTCGAGATTAAACTGATTCCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027405.2-849s21c1
Sequence:CCGGCCCGGATTCACTGTCCATAACCTCGAGGTTATGGACAGTGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027405.2-652s1c1
Sequence:CCGGCTTTCCTAAGCCAACCAGGAACTCGAGTTCCTGGTTGGCTTAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027405.2-1764s1c1
Sequence:CCGGGCTGTGTCTTTGTTCCTGAAACTCGAGTTTCAGGAACAAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027405.2-518s1c1
Sequence:CCGGGAAAGTGTCAGATTGGAGCTACTCGAGTAGCTCCAATCTGACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027405.2-414s1c1
Sequence:CCGGGAGTCTGACTCCTTTACGGAACTCGAGTTCCGTAAAGGAGTCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks