EMAIL THIS PAGE TO A FRIEND

GPATCH3

G patch domain containing 3

57 Gene Product Result for
Synonyms: GPATC3
UniProtKB ID: Q96I76, Q5JYH2, Q8NDJ2, Q9H9Z3
Gene ID:
Mouse(242691) G patch domain containing 3
Rat(362615) G patch domain containing 3
chicken(419577) G patch domain containing 3
cow(514771) G patch domain containing 3
Horse(100057040) G patch domain containing 3
domestic cat(101080810) G patch domain containing 3
dog(487350) G patch domain containing 3
domestic guinea pig(100726564) G patch domain containing 3
naked mole-rat(101719603) G patch domain containing 3
sheep(101109595) G patch domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022078 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102191 MISSION® esiRNA esiRNA human GPATCH3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022078 Rosetta Predictions human pricing
XM_001065500 Rosetta Predictions rat pricing
XM_342933 Rosetta Predictions rat pricing
NM_172876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193116 predicted 754
2 SASI_Hs01_00193118 predicted 285
3 SASI_Hs01_00193119 predicted 1161
4 SASI_Hs01_00193120 predicted 1518
5 SASI_Hs01_00193121 predicted 1459
6 SASI_Hs02_00355447 predicted 1392
7 SASI_Hs02_00355448 predicted 1457
8 SASI_Hs01_00193123 predicted 1237
9 SASI_Hs01_00193124 predicted 1664
10 SASI_Hs02_00355449 predicted 431
11 SASI_Hs01_00193115 predicted 1092
12 SASI_Hs01_00193117 predicted 1404
13 SASI_Hs01_00193122 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314372 predicted 1483
2 SASI_Rn02_00314373 predicted 391
3 SASI_Rn02_00314374 predicted 689
4 SASI_Rn02_00314375 predicted 1566
5 SASI_Rn02_00314376 predicted 810
6 SASI_Rn02_00314377 predicted 475
7 SASI_Rn02_00314378 predicted 411
8 SASI_Rn02_00314379 predicted 890
9 SASI_Rn02_00314380 predicted 684
10 SASI_Rn02_00314381 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395061 predicted 1486
2 SASI_Rn02_00395062 predicted 1569
3 SASI_Rn02_00395063 predicted 1490
4 SASI_Rn02_00395064 predicted 889
5 SASI_Rn02_00395065 predicted 1416
6 SASI_Rn02_00395066 predicted 937
7 SASI_Rn02_00395067 predicted 1412
8 SASI_Rn02_00395068 predicted 1051
9 SASI_Rn02_00395069 predicted 1142
10 SASI_Rn02_00395070 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022815 predicted 1513
2 SASI_Mm01_00022816 predicted 500
3 SASI_Mm01_00022817 predicted 1381
4 SASI_Mm01_00022818 predicted 1227
5 SASI_Mm01_00022819 predicted 715
6 SASI_Mm01_00022820 predicted 1385
7 SASI_Mm01_00022821 predicted 433
8 SASI_Mm01_00022822 predicted 649
9 SASI_Mm01_00022823 predicted 1392
10 SASI_Mm01_00022824 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022078
VALIDATED
GPATCH3 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022078.1-1824s1c1
Sequence:CCGGGTCTTTGGTCTCTAACCCTAACTCGAGTTAGGGTTAGAGACCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022078.1-1159s1c1
Sequence:CCGGGACTCTGTCCAAATGCGTCTACTCGAGTAGACGCATTTGGACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022078.1-299s1c1
Sequence:CCGGGAGACTCTACTCCAATCCAGACTCGAGTCTGGATTGGAGTAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-514s1c1
Sequence:CCGGCAGAGTTGGAAGGCAGAGAATCTCGAGATTCTCTGCCTTCCAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-996s1c1
Sequence:CCGGGATTGAGCTCAAGTGGGAGAACTCGAGTTCTCCCACTTGAGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022078.1-736s1c1
Sequence:CCGGGAGTATGAGGACTCAGAGACTCTCGAGAGTCTCTGAGTCCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022078.1-1059s1c1
Sequence:CCGGGCAGGAGGAAGAAGGAGATTTCTCGAGAAATCTCCTTCTTCCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-358s1c1
Sequence:CCGGGCTCAAGCTCAGAGGCTTATTCTCGAGAATAAGCCTCTGAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-1526s1c1
Sequence:CCGGGCATGAAGTTTCGGACAGACACTCGAGTGTCTGTCCGAAACTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022078.2-1064s21c1
Sequence:CCGGGCAGGAGGAAGAAGGAGATTTCTCGAGAAATCTCCTTCTTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022078.2-211s21c1
Sequence:CCGGCTCCTAACTCTGCCCTAATTCCTCGAGGAATTAGGGCAGAGTTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022078.2-814s21c1
Sequence:CCGGGAACCTACCTGGCAGATATACCTCGAGGTATATCTGCCAGGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022078.2-1865s21c1
Sequence:CCGGTTTGCCTCCTGCAGAACTTTGCTCGAGCAAAGTTCTGCAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022078.2-107s21c1
Sequence:CCGGGGCCCATTTACGGAGCTATTTCTCGAGAAATAGCTCCGTAAATGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022078
VALIDATED
GPATCH3 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022078.1-1824s1c1
Sequence:CCGGGTCTTTGGTCTCTAACCCTAACTCGAGTTAGGGTTAGAGACCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022078.1-1159s1c1
Sequence:CCGGGACTCTGTCCAAATGCGTCTACTCGAGTAGACGCATTTGGACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022078.1-299s1c1
Sequence:CCGGGAGACTCTACTCCAATCCAGACTCGAGTCTGGATTGGAGTAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-514s1c1
Sequence:CCGGCAGAGTTGGAAGGCAGAGAATCTCGAGATTCTCTGCCTTCCAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-996s1c1
Sequence:CCGGGATTGAGCTCAAGTGGGAGAACTCGAGTTCTCCCACTTGAGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022078.1-736s1c1
Sequence:CCGGGAGTATGAGGACTCAGAGACTCTCGAGAGTCTCTGAGTCCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022078.1-1059s1c1
Sequence:CCGGGCAGGAGGAAGAAGGAGATTTCTCGAGAAATCTCCTTCTTCCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-358s1c1
Sequence:CCGGGCTCAAGCTCAGAGGCTTATTCTCGAGAATAAGCCTCTGAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-1526s1c1
Sequence:CCGGGCATGAAGTTTCGGACAGACACTCGAGTGTCTGTCCGAAACTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022078.2-1064s21c1
Sequence:CCGGGCAGGAGGAAGAAGGAGATTTCTCGAGAAATCTCCTTCTTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022078.2-211s21c1
Sequence:CCGGCTCCTAACTCTGCCCTAATTCCTCGAGGAATTAGGGCAGAGTTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022078.2-814s21c1
Sequence:CCGGGAACCTACCTGGCAGATATACCTCGAGGTATATCTGCCAGGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022078.2-1865s21c1
Sequence:CCGGTTTGCCTCCTGCAGAACTTTGCTCGAGCAAAGTTCTGCAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022078.2-107s21c1
Sequence:CCGGGGCCCATTTACGGAGCTATTTCTCGAGAAATAGCTCCGTAAATGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022078
VALIDATED
GPATCH3 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022078.1-1824s1c1
Sequence:CCGGGTCTTTGGTCTCTAACCCTAACTCGAGTTAGGGTTAGAGACCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022078.1-1159s1c1
Sequence:CCGGGACTCTGTCCAAATGCGTCTACTCGAGTAGACGCATTTGGACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022078.1-299s1c1
Sequence:CCGGGAGACTCTACTCCAATCCAGACTCGAGTCTGGATTGGAGTAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-514s1c1
Sequence:CCGGCAGAGTTGGAAGGCAGAGAATCTCGAGATTCTCTGCCTTCCAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-996s1c1
Sequence:CCGGGATTGAGCTCAAGTGGGAGAACTCGAGTTCTCCCACTTGAGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022078.1-736s1c1
Sequence:CCGGGAGTATGAGGACTCAGAGACTCTCGAGAGTCTCTGAGTCCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022078.1-1059s1c1
Sequence:CCGGGCAGGAGGAAGAAGGAGATTTCTCGAGAAATCTCCTTCTTCCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-358s1c1
Sequence:CCGGGCTCAAGCTCAGAGGCTTATTCTCGAGAATAAGCCTCTGAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022078.1-1526s1c1
Sequence:CCGGGCATGAAGTTTCGGACAGACACTCGAGTGTCTGTCCGAAACTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022078.2-1064s21c1
Sequence:CCGGGCAGGAGGAAGAAGGAGATTTCTCGAGAAATCTCCTTCTTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022078.2-211s21c1
Sequence:CCGGCTCCTAACTCTGCCCTAATTCCTCGAGGAATTAGGGCAGAGTTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022078.2-814s21c1
Sequence:CCGGGAACCTACCTGGCAGATATACCTCGAGGTATATCTGCCAGGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022078.2-1865s21c1
Sequence:CCGGTTTGCCTCCTGCAGAACTTTGCTCGAGCAAAGTTCTGCAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022078.2-107s21c1
Sequence:CCGGGGCCCATTTACGGAGCTATTTCTCGAGAAATAGCTCCGTAAATGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172876
GPATCH3 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172876.1-977s1c1
Sequence:CCGGCTCTTCGAGGAGGAGATTGAACTCGAGTTCAATCTCCTCCTCGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-1444s1c1
Sequence:CCGGGCTCATTTCCACCATCTATGACTCGAGTCATAGATGGTGGAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-991s1c1
Sequence:CCGGGATTGAACTTAAGTGGGAGAACTCGAGTTCTCCCACTTAAGTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-478s1c1
Sequence:CCGGCTTTCCCTTTAAGACCCGGAACTCGAGTTCCGGGTCTTAAAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-1528s1c1
Sequence:CCGGGTTTCGGACAGATATGACTTTCTCGAGAAAGTCATATCTGTCCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-1389s1c1
Sequence:CCGGGAGAGAAGTTACAGCCATTTACTCGAGTAAATGGCTGTAACTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172876.2-644s1c1
Sequence:CCGGGTCTACCACCTAGAATCATTACTCGAGTAATGATTCTAGGTGGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172876
GPATCH3 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172876.1-977s1c1
Sequence:CCGGCTCTTCGAGGAGGAGATTGAACTCGAGTTCAATCTCCTCCTCGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-1444s1c1
Sequence:CCGGGCTCATTTCCACCATCTATGACTCGAGTCATAGATGGTGGAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-991s1c1
Sequence:CCGGGATTGAACTTAAGTGGGAGAACTCGAGTTCTCCCACTTAAGTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-478s1c1
Sequence:CCGGCTTTCCCTTTAAGACCCGGAACTCGAGTTCCGGGTCTTAAAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-1528s1c1
Sequence:CCGGGTTTCGGACAGATATGACTTTCTCGAGAAAGTCATATCTGTCCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-1389s1c1
Sequence:CCGGGAGAGAAGTTACAGCCATTTACTCGAGTAAATGGCTGTAACTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172876.2-644s1c1
Sequence:CCGGGTCTACCACCTAGAATCATTACTCGAGTAATGATTCTAGGTGGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172876
GPATCH3 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172876.1-977s1c1
Sequence:CCGGCTCTTCGAGGAGGAGATTGAACTCGAGTTCAATCTCCTCCTCGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-1444s1c1
Sequence:CCGGGCTCATTTCCACCATCTATGACTCGAGTCATAGATGGTGGAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-991s1c1
Sequence:CCGGGATTGAACTTAAGTGGGAGAACTCGAGTTCTCCCACTTAAGTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-478s1c1
Sequence:CCGGCTTTCCCTTTAAGACCCGGAACTCGAGTTCCGGGTCTTAAAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-1528s1c1
Sequence:CCGGGTTTCGGACAGATATGACTTTCTCGAGAAAGTCATATCTGTCCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172876.1-1389s1c1
Sequence:CCGGGAGAGAAGTTACAGCCATTTACTCGAGTAAATGGCTGTAACTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172876.2-644s1c1
Sequence:CCGGGTCTACCACCTAGAATCATTACTCGAGTAATGATTCTAGGTGGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks