EMAIL THIS PAGE TO A FRIEND

GPATCH4

G patch domain containing 4

Synonyms: GPATC4
UniProtKB ID: Q5T3I0, Q5T3I1, Q6ZUE7, Q8IWG8, Q9NXH4
Gene ID:
Mouse(66614) G patch domain containing 4
Rat(295228) G patch domain containing 4
sheep(101105704) G patch domain containing 4
domestic guinea pig(100724501) G patch domain containing 4
naked mole-rat(101717317) G patch domain containing 4
Zebrafish(449898) G patch domain containing 4
cow(768314) G patch domain containing 4
domestic cat(101083650) G patch domain containing 4
dog(480121) G patch domain containing 4
chicken(100859444) G patch domain containing 4
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015590 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083761 MISSION® esiRNA esiRNA human GPATCH4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015590 Rosetta Predictions human pricing
NM_182679 Rosetta Predictions human pricing
NM_001024979 Rosetta Predictions rat pricing
NM_001110809 Rosetta Predictions mouse pricing
NM_025663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017504 predicted 1383
2 SASI_Hs01_00017505 predicted 1600
3 SASI_Hs01_00017506 predicted 1387
4 SASI_Hs01_00017507 predicted 898
5 SASI_Hs01_00017508 predicted 1393
6 SASI_Hs01_00017509 predicted 381
7 SASI_Hs01_00017510 predicted 299
8 SASI_Hs01_00017511 predicted 1614
9 SASI_Hs01_00017512 predicted 303
10 SASI_Hs01_00017513 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144377 predicted 1456
2 SASI_Hs01_00144378 predicted 1668
3 SASI_Hs01_00144379 predicted 1460
4 SASI_Hs01_00144380 predicted 967
5 SASI_Hs01_00144381 predicted 1467
6 SASI_Hs01_00144382 predicted 454
7 SASI_Hs01_00144383 predicted 377
8 SASI_Hs01_00144384 predicted 1694
9 SASI_Hs01_00144385 predicted 374
10 SASI_Hs01_00144386 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110979 predicted 454
2 SASI_Rn01_00110980 predicted 501
3 SASI_Rn01_00110981 predicted 492
4 SASI_Rn01_00110982 predicted 1523
5 SASI_Rn01_00110983 predicted 281
6 SASI_Rn01_00110984 predicted 333
7 SASI_Rn01_00110985 predicted 279
8 SASI_Rn01_00110986 predicted 308
9 SASI_Rn01_00110987 predicted 1584
10 SASI_Rn02_00202853 predicted 371
11 SASI_Rn01_00110988 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305788 predicted 507
2 SASI_Mm02_00305789 predicted 949
3 SASI_Mm02_00305790 predicted 1380
4 SASI_Mm02_00305791 predicted 1389
5 SASI_Mm02_00305792 predicted 1294
6 SASI_Mm02_00305793 predicted 1274
7 SASI_Mm02_00305794 predicted 975
8 SASI_Mm02_00305795 predicted 1018
9 SASI_Mm02_00305796 predicted 1353
10 SASI_Mm02_00305797 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165554 predicted 642
2 SASI_Mm02_00328797 predicted 1076
3 SASI_Mm01_00165555 predicted 1515
4 SASI_Mm01_00165556 predicted 1527
5 SASI_Mm01_00165557 predicted 1427
6 SASI_Mm01_00165558 predicted 1414
7 SASI_Mm02_00328798 predicted 1115
8 SASI_Mm02_00328799 predicted 1149
9 SASI_Mm02_00328800 predicted 1484
10 SASI_Mm01_00165559 predicted 505
11 SASI_Mm01_00165560 predicted 1133
12 SASI_Mm01_00165561 predicted 341
13 SASI_Mm01_00165562 predicted 1145
14 SASI_Mm01_00165563 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015590
VALIDATED
GPATCH4 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-1386s21c1
Sequence:CCGGGAGACTAAAGGTCTGGTAAAGCTCGAGCTTTACCAGACCTTTAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-378s21c1
Sequence:CCGGGTTTGTGAAGATGGCTACATTCTCGAGAATGTAGCCATCTTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-880s21c1
Sequence:CCGGGAATTGAATAGCAGAGAGCAACTCGAGTTGCTCTCTGCTATTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-327s21c1
Sequence:CCGGTAAGGAGACCACCCGTTATAACTCGAGTTATAACGGGTGGTCTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-274s1c1
Sequence:CCGGGCCAACTTGGTAGTGGAAACTCTCGAGAGTTTCCACTACCAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-305s1c1
Sequence:CCGGGAGTACAGATAAGGAGCCTTTCTCGAGAAAGGCTCCTTATCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-378s1c1
Sequence:CCGGGTTTGTGAAGATGGCTACATTCTCGAGAATGTAGCCATCTTCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-880s1c1
Sequence:CCGGGAATTGAATAGCAGAGAGCAACTCGAGTTGCTCTCTGCTATTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015590.2-1087s1c1
Sequence:CCGGGAGGACTTGAACCTAGAAGATCTCGAGATCTTCTAGGTTCAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015590.2-823s1c1
Sequence:CCGGGAGGGTACAACTAAAGGGAATCTCGAGATTCCCTTTAGTTGTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015590
VALIDATED
GPATCH4 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-1386s21c1
Sequence:CCGGGAGACTAAAGGTCTGGTAAAGCTCGAGCTTTACCAGACCTTTAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-378s21c1
Sequence:CCGGGTTTGTGAAGATGGCTACATTCTCGAGAATGTAGCCATCTTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-880s21c1
Sequence:CCGGGAATTGAATAGCAGAGAGCAACTCGAGTTGCTCTCTGCTATTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-327s21c1
Sequence:CCGGTAAGGAGACCACCCGTTATAACTCGAGTTATAACGGGTGGTCTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-274s1c1
Sequence:CCGGGCCAACTTGGTAGTGGAAACTCTCGAGAGTTTCCACTACCAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-305s1c1
Sequence:CCGGGAGTACAGATAAGGAGCCTTTCTCGAGAAAGGCTCCTTATCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-378s1c1
Sequence:CCGGGTTTGTGAAGATGGCTACATTCTCGAGAATGTAGCCATCTTCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-880s1c1
Sequence:CCGGGAATTGAATAGCAGAGAGCAACTCGAGTTGCTCTCTGCTATTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015590.2-1087s1c1
Sequence:CCGGGAGGACTTGAACCTAGAAGATCTCGAGATCTTCTAGGTTCAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015590.2-823s1c1
Sequence:CCGGGAGGGTACAACTAAAGGGAATCTCGAGATTCCCTTTAGTTGTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015590
VALIDATED
GPATCH4 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-1386s21c1
Sequence:CCGGGAGACTAAAGGTCTGGTAAAGCTCGAGCTTTACCAGACCTTTAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-378s21c1
Sequence:CCGGGTTTGTGAAGATGGCTACATTCTCGAGAATGTAGCCATCTTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-880s21c1
Sequence:CCGGGAATTGAATAGCAGAGAGCAACTCGAGTTGCTCTCTGCTATTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015590.2-327s21c1
Sequence:CCGGTAAGGAGACCACCCGTTATAACTCGAGTTATAACGGGTGGTCTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-274s1c1
Sequence:CCGGGCCAACTTGGTAGTGGAAACTCTCGAGAGTTTCCACTACCAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-305s1c1
Sequence:CCGGGAGTACAGATAAGGAGCCTTTCTCGAGAAAGGCTCCTTATCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-378s1c1
Sequence:CCGGGTTTGTGAAGATGGCTACATTCTCGAGAATGTAGCCATCTTCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015590.2-880s1c1
Sequence:CCGGGAATTGAATAGCAGAGAGCAACTCGAGTTGCTCTCTGCTATTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015590.2-1087s1c1
Sequence:CCGGGAGGACTTGAACCTAGAAGATCTCGAGATCTTCTAGGTTCAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015590.2-823s1c1
Sequence:CCGGGAGGGTACAACTAAAGGGAATCTCGAGATTCCCTTTAGTTGTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025663
VALIDATED
GPATCH4 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-1364s21c1
Sequence:CCGGGACTTAGATGTAAGCAGTAAACTCGAGTTTACTGCTTACATCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-417s21c1
Sequence:CCGGATGACCCTGCCAAGGAATTTACTCGAGTAAATTCCTTGGCAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-1583s21c1
Sequence:CCGGGGAGAGCCAATGCATTCTATACTCGAGTATAGAATGCATTGGCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-1417s21c1
Sequence:CCGGAGGTGAGAGAAGTCGGCAATACTCGAGTATTGCCGACTTCTCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-508s21c1
Sequence:CCGGAGTGCAGATAAGACGTCTTTCCTCGAGGAAAGACGTCTTATCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025663.2-657s1c1
Sequence:CCGGCCCAAAGATTCTGACTGATGACTCGAGTCATCAGTCAGAATCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025663.2-1100s1c1
Sequence:CCGGGCAGTAAAGATGATGGTGGGACTCGAGTCCCACCATCATCTTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025663
VALIDATED
GPATCH4 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-1364s21c1
Sequence:CCGGGACTTAGATGTAAGCAGTAAACTCGAGTTTACTGCTTACATCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-417s21c1
Sequence:CCGGATGACCCTGCCAAGGAATTTACTCGAGTAAATTCCTTGGCAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-1583s21c1
Sequence:CCGGGGAGAGCCAATGCATTCTATACTCGAGTATAGAATGCATTGGCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-1417s21c1
Sequence:CCGGAGGTGAGAGAAGTCGGCAATACTCGAGTATTGCCGACTTCTCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-508s21c1
Sequence:CCGGAGTGCAGATAAGACGTCTTTCCTCGAGGAAAGACGTCTTATCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025663.2-657s1c1
Sequence:CCGGCCCAAAGATTCTGACTGATGACTCGAGTCATCAGTCAGAATCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025663.2-1100s1c1
Sequence:CCGGGCAGTAAAGATGATGGTGGGACTCGAGTCCCACCATCATCTTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025663
VALIDATED
GPATCH4 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-1364s21c1
Sequence:CCGGGACTTAGATGTAAGCAGTAAACTCGAGTTTACTGCTTACATCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-417s21c1
Sequence:CCGGATGACCCTGCCAAGGAATTTACTCGAGTAAATTCCTTGGCAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-1583s21c1
Sequence:CCGGGGAGAGCCAATGCATTCTATACTCGAGTATAGAATGCATTGGCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-1417s21c1
Sequence:CCGGAGGTGAGAGAAGTCGGCAATACTCGAGTATTGCCGACTTCTCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025663.3-508s21c1
Sequence:CCGGAGTGCAGATAAGACGTCTTTCCTCGAGGAAAGACGTCTTATCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025663.2-657s1c1
Sequence:CCGGCCCAAAGATTCTGACTGATGACTCGAGTCATCAGTCAGAATCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025663.2-1100s1c1
Sequence:CCGGGCAGTAAAGATGATGGTGGGACTCGAGTCCCACCATCATCTTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks