EMAIL THIS PAGE TO A FRIEND

GPATCH8

G patch domain containing 8

Synonyms: GPATC8 KIAA0553
UniProtKB ID: Q9UKJ3, B9EGP9, O60300, Q8TB99
Gene ID:
Mouse(237943) G patch domain containing 8
Rat(685233) G patch domain containing 8
Zebrafish(565404) G patch domain containing 8
chicken(426522) G patch domain containing 8
cow(534759) G patch domain containing 8
domestic cat(101101177) G patch domain containing 8
dog(480500) G patch domain containing 8
domestic guinea pig(100727097) G patch domain containing 8
naked mole-rat(101713757) G patch domain containing 8
sheep(101115975) G patch domain containing 8
Domestic Rabbit(100350034) G patch domain containing 8
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044380 Anti-GPATCH8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002909 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001159492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001159492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001159492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002909 Rosetta Predictions human pricing
XM_001062937 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016007 predicted 1834
2 SASI_Hs02_00304254 predicted 2835
3 SASI_Hs01_00016009 predicted 575
4 SASI_Hs01_00016010 predicted 3865
5 SASI_Hs01_00016011 predicted 399
6 SASI_Hs01_00016012 predicted 2721
7 SASI_Hs02_00304255 predicted 1373
8 SASI_Hs01_00016014 predicted 2649
9 SASI_Hs02_00304256 predicted 1430
10 SASI_Hs02_00304257 predicted 1754
11 SASI_Hs01_00016008 predicted 2951
12 SASI_Hs01_00016013 predicted 1436
13 SASI_Hs01_00016015 predicted 1320
14 SASI_Hs01_00016016 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305186 predicted 2643
2 SASI_Rn02_00305187 predicted 514
3 SASI_Rn02_00305188 predicted 3329
4 SASI_Rn02_00305189 predicted 1467
5 SASI_Rn02_00305190 predicted 2688
6 SASI_Rn02_00305191 predicted 2677
7 SASI_Rn02_00305192 predicted 1729
8 SASI_Rn02_00305193 predicted 608
9 SASI_Rn02_00305194 predicted 3364
10 SASI_Rn02_00305195 predicted 2754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002909
VALIDATED
GPATCH8 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002909.1-3929s1c1
Sequence:CCGGCCTAGTATTGAGTCAACAGATCTCGAGATCTGTTGACTCAATACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002909.1-5472s1c1
Sequence:CCGGGCTCTTTAAGTGATCCTCGTTCTCGAGAACGAGGATCACTTAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002909.1-5296s21c1
Sequence:CCGGGTCTAAAGTGAAGGGTATATTCTCGAGAATATACCCTTCACTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002909.1-4267s21c1
Sequence:CCGGACTTGCCCAGGTGCATCATATCTCGAGATATGATGCACCTGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002909.1-3612s21c1
Sequence:CCGGGGAGTAGTGATGCCCTATTTGCTCGAGCAAATAGGGCATCACTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002909.1-2711s21c1
Sequence:CCGGTATAGTAGACAGCGCAGTTACCTCGAGGTAACTGCGCTGTCTACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002909.1-171s21c1
Sequence:CCGGAGCCTATAGAATCGGATAATACTCGAGTATTATCCGATTCTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002909
VALIDATED
GPATCH8 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002909.1-3929s1c1
Sequence:CCGGCCTAGTATTGAGTCAACAGATCTCGAGATCTGTTGACTCAATACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002909.1-5472s1c1
Sequence:CCGGGCTCTTTAAGTGATCCTCGTTCTCGAGAACGAGGATCACTTAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002909.1-5296s21c1
Sequence:CCGGGTCTAAAGTGAAGGGTATATTCTCGAGAATATACCCTTCACTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002909.1-4267s21c1
Sequence:CCGGACTTGCCCAGGTGCATCATATCTCGAGATATGATGCACCTGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002909.1-3612s21c1
Sequence:CCGGGGAGTAGTGATGCCCTATTTGCTCGAGCAAATAGGGCATCACTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002909.1-2711s21c1
Sequence:CCGGTATAGTAGACAGCGCAGTTACCTCGAGGTAACTGCGCTGTCTACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002909.1-171s21c1
Sequence:CCGGAGCCTATAGAATCGGATAATACTCGAGTATTATCCGATTCTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002909
VALIDATED
GPATCH8 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002909.1-3929s1c1
Sequence:CCGGCCTAGTATTGAGTCAACAGATCTCGAGATCTGTTGACTCAATACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002909.1-5472s1c1
Sequence:CCGGGCTCTTTAAGTGATCCTCGTTCTCGAGAACGAGGATCACTTAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002909.1-5296s21c1
Sequence:CCGGGTCTAAAGTGAAGGGTATATTCTCGAGAATATACCCTTCACTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002909.1-4267s21c1
Sequence:CCGGACTTGCCCAGGTGCATCATATCTCGAGATATGATGCACCTGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002909.1-3612s21c1
Sequence:CCGGGGAGTAGTGATGCCCTATTTGCTCGAGCAAATAGGGCATCACTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002909.1-2711s21c1
Sequence:CCGGTATAGTAGACAGCGCAGTTACCTCGAGGTAACTGCGCTGTCTACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002909.1-171s21c1
Sequence:CCGGAGCCTATAGAATCGGATAATACTCGAGTATTATCCGATTCTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001159492
VALIDATED
GPATCH8 MISSION shRNA Bacterial Glycerol Stock
G patch domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159492.1-4347s21c1
Sequence:CCGGCTAGCCACCCTATCCATATAACTCGAGTTATATGGATAGGGTGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-4720s21c1
Sequence:CCGGGGTTTACTATCAGGGATATTTCTCGAGAAATATCCCTGATAGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-818s21c1
Sequence:CCGGACGTCAGTACAGATCACTAATCTCGAGATTAGTGATCTGTACTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-1841s21c1
Sequence:CCGGGATCCTAGAGAACCGAATAAACTCGAGTTTATTCGGTTCTCTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-142s21c1
Sequence:CCGGGCCCATAGAATCGGATAATATCTCGAGATATTATCCGATTCTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001159492
VALIDATED
GPATCH8 MISSION shRNA shRNA Plasmid DNA
G patch domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159492.1-4347s21c1
Sequence:CCGGCTAGCCACCCTATCCATATAACTCGAGTTATATGGATAGGGTGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-4720s21c1
Sequence:CCGGGGTTTACTATCAGGGATATTTCTCGAGAAATATCCCTGATAGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-818s21c1
Sequence:CCGGACGTCAGTACAGATCACTAATCTCGAGATTAGTGATCTGTACTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-1841s21c1
Sequence:CCGGGATCCTAGAGAACCGAATAAACTCGAGTTTATTCGGTTCTCTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-142s21c1
Sequence:CCGGGCCCATAGAATCGGATAATATCTCGAGATATTATCCGATTCTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001159492
VALIDATED
GPATCH8 MISSION shRNA Lentiviral Transduction Particles
G patch domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159492.1-4347s21c1
Sequence:CCGGCTAGCCACCCTATCCATATAACTCGAGTTATATGGATAGGGTGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-4720s21c1
Sequence:CCGGGGTTTACTATCAGGGATATTTCTCGAGAAATATCCCTGATAGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-818s21c1
Sequence:CCGGACGTCAGTACAGATCACTAATCTCGAGATTAGTGATCTGTACTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-1841s21c1
Sequence:CCGGGATCCTAGAGAACCGAATAAACTCGAGTTTATTCGGTTCTCTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001159492.1-142s21c1
Sequence:CCGGGCCCATAGAATCGGATAATATCTCGAGATATTATCCGATTCTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks