EMAIL THIS PAGE TO A FRIEND

GPBP1

GC-rich promoter binding protein 1

Synonyms: GPBP SSH6 VASCULIN
UniProtKB ID: Q86WP2, A6NKW3, Q6NSH6, Q9H0D4, Q9H785, Q9NSN4
Gene ID:
Human(65056) Summary: This gene was originally isolated by subtractive hybridization of cDNAs expressed in atherosclerotic plaques with a thrombus, and was found to be expressed only in vascular smooth muscle cells. However, a shorter splice variant was found to be more ubiquitously expressed. This protein is suggested to play a role in the development of atherosclerosis. Studies in mice suggest that it may also function as a GC-rich promoter-specific trans-activating transcription factor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Mouse(73274) GC-rich promoter binding protein 1
Rat(294734) GC-rich promoter binding protein 1
domestic guinea pig(100722353) GC-rich promoter binding protein 1
sheep(101111125) GC-rich promoter binding protein 1
Domestic Rabbit(100350089) GC-rich promoter binding protein 1
chicken(427148) GC-rich promoter binding protein 1
dog(478062) GC-rich promoter binding protein 1
cow(613751) GC-rich promoter binding protein 1
domestic cat(101091593) GC-rich promoter binding protein 1
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127235 Rosetta Predictions human pricing
NM_001127236 Rosetta Predictions human pricing
NM_022913 Rosetta Predictions human pricing
NM_001106410 Rosetta Predictions rat pricing
NM_001122963 Rosetta Predictions mouse pricing
NM_028487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328977 predicted 2057
2 SASI_Hs02_00328978 predicted 2665
3 SASI_Hs02_00328979 predicted 2346
4 SASI_Hs02_00328980 predicted 2330
5 SASI_Hs02_00328981 predicted 2543
6 SASI_Hs02_00328982 predicted 2600
7 SASI_Hs02_00328983 predicted 2120
8 SASI_Hs02_00328984 predicted 2419
9 SASI_Hs02_00328985 predicted 2028
10 SASI_Hs02_00328986 predicted 2528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328987 predicted 747
2 SASI_Hs02_00328988 predicted 1365
3 SASI_Hs02_00328989 predicted 1050
4 SASI_Hs02_00328990 predicted 1026
5 SASI_Hs02_00328991 predicted 1244
6 SASI_Hs02_00328992 predicted 1291
7 SASI_Hs02_00328993 predicted 826
8 SASI_Hs02_00328994 predicted 1122
9 SASI_Hs02_00328995 predicted 730
10 SASI_Hs02_00328996 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356228 predicted 1993
2 SASI_Hs02_00356229 predicted 2604
3 SASI_Hs02_00356230 predicted 2286
4 SASI_Hs02_00356231 predicted 2267
5 SASI_Hs02_00356232 predicted 2488
6 SASI_Hs01_00181407 predicted 2538
7 SASI_Hs01_00181408 predicted 2062
8 SASI_Hs01_00181409 predicted 2357
9 SASI_Hs02_00356233 predicted 1972
10 SASI_Hs01_00181410 predicted 2473
11 SASI_Hs01_00181401 predicted 1707
12 SASI_Hs01_00181402 predicted 1384
13 SASI_Hs01_00181403 predicted 1256
14 SASI_Hs01_00181404 predicted 1629
15 SASI_Hs01_00181405 predicted 1582
16 SASI_Hs01_00181406 predicted 1552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218688 predicted 1853
2 SASI_Rn02_00218689 predicted 1656
3 SASI_Rn02_00218690 predicted 1565
4 SASI_Rn02_00218691 predicted 1603
5 SASI_Rn02_00218692 predicted 1149
6 SASI_Rn02_00218693 predicted 1578
7 SASI_Rn02_00218694 predicted 2153
8 SASI_Rn02_00218695 predicted 1786
9 SASI_Rn02_00218696 predicted 2515
10 SASI_Rn02_00218697 predicted 2319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309689 predicted 2343
2 SASI_Mm02_00309690 predicted 2123
3 SASI_Mm02_00309691 predicted 2098
4 SASI_Mm02_00309692 predicted 2044
5 SASI_Mm02_00309693 predicted 1479
6 SASI_Mm02_00309694 predicted 2542
7 SASI_Mm02_00309695 predicted 2419
8 SASI_Mm02_00309696 predicted 2049
9 SASI_Mm02_00309697 predicted 2593
10 SASI_Mm02_00309698 predicted 2636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333953 predicted 2402
2 SASI_Mm01_00076431 predicted 2182
3 SASI_Mm02_00333954 predicted 2158
4 SASI_Mm02_00333955 predicted 2109
5 SASI_Mm01_00076434 predicted 1475
6 SASI_Mm02_00333956 predicted 2603
7 SASI_Mm02_00333957 predicted 2479
8 SASI_Mm01_00076436 predicted 2110
9 SASI_Mm01_00076437 predicted 2653
10 SASI_Mm02_00333958 predicted 2690
11 SASI_Mm01_00076432 predicted 1692
12 SASI_Mm01_00076433 predicted 1730
13 SASI_Mm01_00076435 predicted 1711
14 SASI_Mm01_00076438 predicted 1403
15 SASI_Mm01_00076439 predicted 1783
16 SASI_Mm01_00076440 predicted 2386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022913
VALIDATED
GPBP1 MISSION shRNA Bacterial Glycerol Stock
GC-rich promoter binding protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022913.1-1532s1c1
Sequence:CCGGGAGTATGAGAGAGAACCAAATCTCGAGATTTGGTTCTCTCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022913.1-1872s1c1
Sequence:CCGGCCAAGAACTTTAGTCCATCTACTCGAGTAGATGGACTAAAGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022913.1-2252s1c1
Sequence:CCGGGAGGCAGAACACAGATTGTTACTCGAGTAACAATCTGTGTTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022913.1-1238s1c1
Sequence:CCGGCGACGACACAACTCTTCAGATCTCGAGATCTGAAGAGTTGTGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022913.1-2501s1c1
Sequence:CCGGGATACATCAGATGACGACGATCTCGAGATCGTCGTCATCTGATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022913.1-1961s1c1
Sequence:CCGGCGTCTAACCAAACTGACACGACTCGAGTCGTGTCAGTTTGGTTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022913.1-1454s1c1
Sequence:CCGGGACAATGAAACCGGGAGGAAACTCGAGTTTCCTCCCGGTTTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022913.1-2484s1c1
Sequence:CCGGCAGAGACAAGTAGCAGTGATACTCGAGTATCACTGCTACTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022913.1-1205s1c1
Sequence:CCGGGCATGGACAGAGAATCGTTATCTCGAGATAACGATTCTCTGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-1752s21c1
Sequence:CCGGGAATATCCTCCGAATCCTAAACTCGAGTTTAGGATTCGGAGGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-1326s21c1
Sequence:CCGGTCATCAACAAAGTCGTCATTGCTCGAGCAATGACGACTTTGTTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-2241s21c1
Sequence:CCGGGAGAAGGATGACGACTCATTTCTCGAGAAATGAGTCGTCATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-2002s21c1
Sequence:CCGGCATTTGGCGTTGGCAACTTTACTCGAGTAAAGTTGCCAACGCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-1437s21c1
Sequence:CCGGTCTGCTATTGGGCGTCCTAATCTCGAGATTAGGACGCCCAATAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022913
VALIDATED
GPBP1 MISSION shRNA shRNA Plasmid DNA
GC-rich promoter binding protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022913.1-1532s1c1
Sequence:CCGGGAGTATGAGAGAGAACCAAATCTCGAGATTTGGTTCTCTCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022913.1-1872s1c1
Sequence:CCGGCCAAGAACTTTAGTCCATCTACTCGAGTAGATGGACTAAAGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022913.1-2252s1c1
Sequence:CCGGGAGGCAGAACACAGATTGTTACTCGAGTAACAATCTGTGTTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022913.1-1238s1c1
Sequence:CCGGCGACGACACAACTCTTCAGATCTCGAGATCTGAAGAGTTGTGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022913.1-2501s1c1
Sequence:CCGGGATACATCAGATGACGACGATCTCGAGATCGTCGTCATCTGATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022913.1-1961s1c1
Sequence:CCGGCGTCTAACCAAACTGACACGACTCGAGTCGTGTCAGTTTGGTTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022913.1-1454s1c1
Sequence:CCGGGACAATGAAACCGGGAGGAAACTCGAGTTTCCTCCCGGTTTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022913.1-2484s1c1
Sequence:CCGGCAGAGACAAGTAGCAGTGATACTCGAGTATCACTGCTACTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022913.1-1205s1c1
Sequence:CCGGGCATGGACAGAGAATCGTTATCTCGAGATAACGATTCTCTGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-1752s21c1
Sequence:CCGGGAATATCCTCCGAATCCTAAACTCGAGTTTAGGATTCGGAGGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-1326s21c1
Sequence:CCGGTCATCAACAAAGTCGTCATTGCTCGAGCAATGACGACTTTGTTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-2241s21c1
Sequence:CCGGGAGAAGGATGACGACTCATTTCTCGAGAAATGAGTCGTCATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-2002s21c1
Sequence:CCGGCATTTGGCGTTGGCAACTTTACTCGAGTAAAGTTGCCAACGCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-1437s21c1
Sequence:CCGGTCTGCTATTGGGCGTCCTAATCTCGAGATTAGGACGCCCAATAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022913
VALIDATED
GPBP1 MISSION shRNA Lentiviral Transduction Particles
GC-rich promoter binding protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022913.1-1532s1c1
Sequence:CCGGGAGTATGAGAGAGAACCAAATCTCGAGATTTGGTTCTCTCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022913.1-1872s1c1
Sequence:CCGGCCAAGAACTTTAGTCCATCTACTCGAGTAGATGGACTAAAGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022913.1-2252s1c1
Sequence:CCGGGAGGCAGAACACAGATTGTTACTCGAGTAACAATCTGTGTTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022913.1-1238s1c1
Sequence:CCGGCGACGACACAACTCTTCAGATCTCGAGATCTGAAGAGTTGTGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022913.1-2501s1c1
Sequence:CCGGGATACATCAGATGACGACGATCTCGAGATCGTCGTCATCTGATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022913.1-1961s1c1
Sequence:CCGGCGTCTAACCAAACTGACACGACTCGAGTCGTGTCAGTTTGGTTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022913.1-1454s1c1
Sequence:CCGGGACAATGAAACCGGGAGGAAACTCGAGTTTCCTCCCGGTTTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022913.1-2484s1c1
Sequence:CCGGCAGAGACAAGTAGCAGTGATACTCGAGTATCACTGCTACTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022913.1-1205s1c1
Sequence:CCGGGCATGGACAGAGAATCGTTATCTCGAGATAACGATTCTCTGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-1752s21c1
Sequence:CCGGGAATATCCTCCGAATCCTAAACTCGAGTTTAGGATTCGGAGGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-1326s21c1
Sequence:CCGGTCATCAACAAAGTCGTCATTGCTCGAGCAATGACGACTTTGTTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-2241s21c1
Sequence:CCGGGAGAAGGATGACGACTCATTTCTCGAGAAATGAGTCGTCATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-2002s21c1
Sequence:CCGGCATTTGGCGTTGGCAACTTTACTCGAGTAAAGTTGCCAACGCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022913.2-1437s21c1
Sequence:CCGGTCTGCTATTGGGCGTCCTAATCTCGAGATTAGGACGCCCAATAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028487
VALIDATED
GPBP1 MISSION shRNA Bacterial Glycerol Stock
GC-rich promoter binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-2860s1c1
Sequence:CCGGGCATTTCTCTTGACTAGCAATCTCGAGATTGCTAGTCAAGAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-2432s1c1
Sequence:CCGGCCAAGTTATTAGTGAACAGTTCTCGAGAACTGTTCACTAATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028487.2-2188s1c1
Sequence:CCGGGCAATACTACTCACCAAGAAACTCGAGTTTCTTGGTGAGTAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-1260s1c1
Sequence:CCGGCGACGACACAATTCTTCAGATCTCGAGATCTGAAGAATTGTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-1703s1c1
Sequence:CCGGGCTGGTCATTAAGAAAGGTAACTCGAGTTACCTTTCTTAATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028487.4-1905s21c1
Sequence:CCGGGCTGGTCATTAAGAAAGGTAACTCGAGTTACCTTTCTTAATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028487.4-3063s21c1
Sequence:CCGGGCATTTCTCTTGACTAGCAATCTCGAGATTGCTAGTCAAGAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028487.4-2390s21c1
Sequence:CCGGGCAATACTACTCACCAAGAAACTCGAGTTTCTTGGTGAGTAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028487.4-1462s21c1
Sequence:CCGGCGACGACACAATTCTTCAGATCTCGAGATCTGAAGAATTGTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028487
VALIDATED
GPBP1 MISSION shRNA shRNA Plasmid DNA
GC-rich promoter binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-2860s1c1
Sequence:CCGGGCATTTCTCTTGACTAGCAATCTCGAGATTGCTAGTCAAGAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-2432s1c1
Sequence:CCGGCCAAGTTATTAGTGAACAGTTCTCGAGAACTGTTCACTAATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028487.2-2188s1c1
Sequence:CCGGGCAATACTACTCACCAAGAAACTCGAGTTTCTTGGTGAGTAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-1260s1c1
Sequence:CCGGCGACGACACAATTCTTCAGATCTCGAGATCTGAAGAATTGTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-1703s1c1
Sequence:CCGGGCTGGTCATTAAGAAAGGTAACTCGAGTTACCTTTCTTAATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028487.4-1905s21c1
Sequence:CCGGGCTGGTCATTAAGAAAGGTAACTCGAGTTACCTTTCTTAATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028487.4-3063s21c1
Sequence:CCGGGCATTTCTCTTGACTAGCAATCTCGAGATTGCTAGTCAAGAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028487.4-2390s21c1
Sequence:CCGGGCAATACTACTCACCAAGAAACTCGAGTTTCTTGGTGAGTAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028487.4-1462s21c1
Sequence:CCGGCGACGACACAATTCTTCAGATCTCGAGATCTGAAGAATTGTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028487
VALIDATED
GPBP1 MISSION shRNA Lentiviral Transduction Particles
GC-rich promoter binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-2860s1c1
Sequence:CCGGGCATTTCTCTTGACTAGCAATCTCGAGATTGCTAGTCAAGAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-2432s1c1
Sequence:CCGGCCAAGTTATTAGTGAACAGTTCTCGAGAACTGTTCACTAATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028487.2-2188s1c1
Sequence:CCGGGCAATACTACTCACCAAGAAACTCGAGTTTCTTGGTGAGTAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-1260s1c1
Sequence:CCGGCGACGACACAATTCTTCAGATCTCGAGATCTGAAGAATTGTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028487.2-1703s1c1
Sequence:CCGGGCTGGTCATTAAGAAAGGTAACTCGAGTTACCTTTCTTAATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028487.4-1905s21c1
Sequence:CCGGGCTGGTCATTAAGAAAGGTAACTCGAGTTACCTTTCTTAATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028487.4-3063s21c1
Sequence:CCGGGCATTTCTCTTGACTAGCAATCTCGAGATTGCTAGTCAAGAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028487.4-2390s21c1
Sequence:CCGGGCAATACTACTCACCAAGAAACTCGAGTTTCTTGGTGAGTAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028487.4-1462s21c1
Sequence:CCGGCGACGACACAATTCTTCAGATCTCGAGATCTGAAGAATTGTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks