EMAIL THIS PAGE TO A FRIEND

GPC1

glypican 1

54 Gene Product Result for
Synonyms: glypican
UniProtKB ID: P35052, Q53QM4
Gene ID:
Human(2817) Summary: Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
Mouse(14733) glypican 1
Rat(58920) glypican 1
chicken(424770) glypican 1
cow(518114) glypican 1
dog(486197) glypican 1
sheep(101104709) glypican 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0794 AQUA Peptide GCPDDITVMVV[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002081 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002081 Rosetta Predictions human pricing
NM_030828 Rosetta Predictions rat pricing
NM_016696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186003 predicted 1235
2 SASI_Hs01_00186005 predicted 2124
3 SASI_Hs01_00186007 predicted 1947
4 SASI_Hs02_00333158 predicted 963
5 SASI_Hs02_00333159 predicted 1846
6 SASI_Hs02_00333160 predicted 1940
7 SASI_Hs01_00186009 predicted 1920
8 SASI_Hs01_00186010 predicted 965
9 SASI_Hs01_00186011 predicted 2209
10 SASI_Hs01_00186012 predicted 1775
11 SASI_Hs01_00186004 predicted 1109
12 SASI_Hs01_00186006 predicted 1694
13 SASI_Hs01_00186008 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050086 predicted 563
2 SASI_Rn01_00050087 predicted 1823
3 SASI_Rn01_00050088 predicted 1152
4 SASI_Rn01_00050089 predicted 962
5 SASI_Rn01_00050090 predicted 1436
6 SASI_Rn01_00050091 predicted 1315
7 SASI_Rn01_00050092 predicted 1564
8 SASI_Rn01_00050093 predicted 1792
9 SASI_Rn01_00050094 predicted 645
10 SASI_Rn01_00050095 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323358 predicted 2205
2 SASI_Mm01_00166801 predicted 2135
3 SASI_Mm02_00323359 predicted 450
4 SASI_Mm01_00166803 predicted 985
5 SASI_Mm01_00166804 predicted 462
6 SASI_Mm01_00166805 predicted 1950
7 SASI_Mm01_00166806 predicted 1633
8 SASI_Mm01_00166807 predicted 2005
9 SASI_Mm01_00166809 predicted 1955
10 SASI_Mm01_00166810 predicted 1579
11 SASI_Mm01_00166802 predicted 1411
12 SASI_Mm01_00166808 predicted 1964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002081
VALIDATED
GPC1 MISSION shRNA Bacterial Glycerol Stock
glypican 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1925s1c1
Sequence:CCGGCCAAGGACTGACTTTGCCAAACTCGAGTTTGGCAAAGTCAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1023s1c1
Sequence:CCGGTGCCCTGACTATTGCCGAAATCTCGAGATTTCGGCAATAGTCAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-533s1c1
Sequence:CCGGGCGCAGCTTCGATGACCACTTCTCGAGAAGTGGTCATCGAAGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1031s1c1
Sequence:CCGGCTATTGCCGAAATGTGCTCAACTCGAGTTGAGCACATTTCGGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1415s1c1
Sequence:CCGGGACACTGTGCAGTGAGAAGATCTCGAGATCTTCTCACTGCACAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002081.2-533s21c1
Sequence:CCGGGCGCAGCTTCGATGACCACTTCTCGAGAAGTGGTCATCGAAGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002081.2-1031s21c1
Sequence:CCGGCTATTGCCGAAATGTGCTCAACTCGAGTTGAGCACATTTCGGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002081.2-1023s21c1
Sequence:CCGGTGCCCTGACTATTGCCGAAATCTCGAGATTTCGGCAATAGTCAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002081.2-1925s21c1
Sequence:CCGGCCAAGGACTGACTTTGCCAAACTCGAGTTTGGCAAAGTCAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002081
VALIDATED
GPC1 MISSION shRNA shRNA Plasmid DNA
glypican 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1925s1c1
Sequence:CCGGCCAAGGACTGACTTTGCCAAACTCGAGTTTGGCAAAGTCAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1023s1c1
Sequence:CCGGTGCCCTGACTATTGCCGAAATCTCGAGATTTCGGCAATAGTCAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-533s1c1
Sequence:CCGGGCGCAGCTTCGATGACCACTTCTCGAGAAGTGGTCATCGAAGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1031s1c1
Sequence:CCGGCTATTGCCGAAATGTGCTCAACTCGAGTTGAGCACATTTCGGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1415s1c1
Sequence:CCGGGACACTGTGCAGTGAGAAGATCTCGAGATCTTCTCACTGCACAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002081.2-533s21c1
Sequence:CCGGGCGCAGCTTCGATGACCACTTCTCGAGAAGTGGTCATCGAAGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002081.2-1031s21c1
Sequence:CCGGCTATTGCCGAAATGTGCTCAACTCGAGTTGAGCACATTTCGGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002081.2-1023s21c1
Sequence:CCGGTGCCCTGACTATTGCCGAAATCTCGAGATTTCGGCAATAGTCAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002081.2-1925s21c1
Sequence:CCGGCCAAGGACTGACTTTGCCAAACTCGAGTTTGGCAAAGTCAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002081
VALIDATED
GPC1 MISSION shRNA Lentiviral Transduction Particles
glypican 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1925s1c1
Sequence:CCGGCCAAGGACTGACTTTGCCAAACTCGAGTTTGGCAAAGTCAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1023s1c1
Sequence:CCGGTGCCCTGACTATTGCCGAAATCTCGAGATTTCGGCAATAGTCAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-533s1c1
Sequence:CCGGGCGCAGCTTCGATGACCACTTCTCGAGAAGTGGTCATCGAAGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1031s1c1
Sequence:CCGGCTATTGCCGAAATGTGCTCAACTCGAGTTGAGCACATTTCGGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002081.1-1415s1c1
Sequence:CCGGGACACTGTGCAGTGAGAAGATCTCGAGATCTTCTCACTGCACAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002081.2-533s21c1
Sequence:CCGGGCGCAGCTTCGATGACCACTTCTCGAGAAGTGGTCATCGAAGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002081.2-1031s21c1
Sequence:CCGGCTATTGCCGAAATGTGCTCAACTCGAGTTGAGCACATTTCGGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002081.2-1023s21c1
Sequence:CCGGTGCCCTGACTATTGCCGAAATCTCGAGATTTCGGCAATAGTCAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002081.2-1925s21c1
Sequence:CCGGCCAAGGACTGACTTTGCCAAACTCGAGTTTGGCAAAGTCAGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016696
VALIDATED
GPC1 MISSION shRNA Bacterial Glycerol Stock
glypican 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-975s1c1
Sequence:CCGGCCCAGAATGTTCTCGGGCCATCTCGAGATGGCCCGAGAACATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-2421s1c1
Sequence:CCGGGCCTTCAAGTTTATGCATGATCTCGAGATCATGCATAAACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-1608s1c1
Sequence:CCGGCCAGCAGATTATGCAGCTCAACTCGAGTTGAGCTGCATAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016696.1-440s1c1
Sequence:CCGGAGGGCTACACTTGCTGTACTACTCGAGTAGTACAGCAAGTGTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-1611s1c1
Sequence:CCGGGCAGATTATGCAGCTCAAGATCTCGAGATCTTGAGCTGCATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016696
VALIDATED
GPC1 MISSION shRNA shRNA Plasmid DNA
glypican 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-975s1c1
Sequence:CCGGCCCAGAATGTTCTCGGGCCATCTCGAGATGGCCCGAGAACATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-2421s1c1
Sequence:CCGGGCCTTCAAGTTTATGCATGATCTCGAGATCATGCATAAACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-1608s1c1
Sequence:CCGGCCAGCAGATTATGCAGCTCAACTCGAGTTGAGCTGCATAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016696.1-440s1c1
Sequence:CCGGAGGGCTACACTTGCTGTACTACTCGAGTAGTACAGCAAGTGTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-1611s1c1
Sequence:CCGGGCAGATTATGCAGCTCAAGATCTCGAGATCTTGAGCTGCATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016696
VALIDATED
GPC1 MISSION shRNA Lentiviral Transduction Particles
glypican 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-975s1c1
Sequence:CCGGCCCAGAATGTTCTCGGGCCATCTCGAGATGGCCCGAGAACATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-2421s1c1
Sequence:CCGGGCCTTCAAGTTTATGCATGATCTCGAGATCATGCATAAACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-1608s1c1
Sequence:CCGGCCAGCAGATTATGCAGCTCAACTCGAGTTGAGCTGCATAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016696.1-440s1c1
Sequence:CCGGAGGGCTACACTTGCTGTACTACTCGAGTAGTACAGCAAGTGTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016696.1-1611s1c1
Sequence:CCGGGCAGATTATGCAGCTCAAGATCTCGAGATCTTGAGCTGCATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks