EMAIL THIS PAGE TO A FRIEND

GPC2

glypican 2

100 Gene Product Result for
UniProtKB ID: Q8N158, A4D2A7
Gene ID:
Mouse(71951) glypican 2 (cerebroglycan)
Rat(171517) glypican 2
Zebrafish(503792) glypican 2
cow(618005) glypican 2
dog(608542) glypican 2
sheep(101122658) glypican 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302079 ANTI-GPC2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152742 Rosetta Predictions human pricing
NM_138511 Rosetta Predictions rat pricing
NM_172412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138084 predicted 1056
2 SASI_Hs01_00138085 predicted 754
3 SASI_Hs01_00138087 predicted 1881
4 SASI_Hs01_00138088 predicted 994
5 SASI_Hs01_00138089 predicted 508
6 SASI_Hs02_00366658 predicted 366
7 SASI_Hs01_00138090 predicted 2143
8 SASI_Hs01_00138091 predicted 359
9 SASI_Hs01_00138092 predicted 1623
10 SASI_Hs01_00138093 predicted 715
11 SASI_Hs01_00138086 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070657 predicted 1383
2 SASI_Rn01_00070658 predicted 570
3 SASI_Rn02_00268110 predicted 1235
4 SASI_Rn01_00070659 predicted 539
5 SASI_Rn01_00070660 predicted 1368
6 SASI_Rn01_00070661 predicted 1322
7 SASI_Rn01_00070662 predicted 419
8 SASI_Rn01_00070663 predicted 1579
9 SASI_Rn01_00070664 predicted 953
10 SASI_Rn01_00070666 predicted 808
11 SASI_Rn01_00070665 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164845 predicted 362
2 SASI_Mm01_00164846 predicted 427
3 SASI_Mm01_00164847 predicted 459
4 SASI_Mm01_00164848 predicted 890
5 SASI_Mm01_00164849 predicted 1268
6 SASI_Mm01_00164850 predicted 276
7 SASI_Mm01_00164851 predicted 1085
8 SASI_Mm01_00164852 predicted 1257
9 SASI_Mm01_00164853 predicted 1580
10 SASI_Mm01_00164854 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152742
GPC2 MISSION shRNA Bacterial Glycerol Stock
glypican 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152742.1-2004s21c1
Sequence:CCGGGAGGGTAGAGAAGGGACTTTGCTCGAGCAAAGTCCCTTCTCTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-876s1c1
Sequence:CCGGTGTGGTCAGCGAAGCGCTTAACTCGAGTTAAGCGCTTCGCTGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-294s1c1
Sequence:CCGGGGGATATAGCTTAAACCTAATCTCGAGATTAGGTTTAAGCTATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152742.1-647s21c1
Sequence:CCGGATGACACCCTGGCGGATTTCTCTCGAGAGAAATCCGCCAGGGTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152742.1-2165s21c1
Sequence:CCGGTATAGTCTCCAGCCCTCTAAGCTCGAGCTTAGAGGGCTGGAGACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-1148s1c1
Sequence:CCGGGTTTGATGTACCTGCAGGAAACTCGAGTTTCCTGCAGGTACATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152742.1-2492s1c1
Sequence:CCGGGAGTCCATGTTTATTCTGCAACTCGAGTTGCAGAATAAACATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-1686s1c1
Sequence:CCGGGCAGTATGCAGATGACTGGATCTCGAGATCCAGTCATCTGCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152742
GPC2 MISSION shRNA shRNA Plasmid DNA
glypican 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152742.1-2004s21c1
Sequence:CCGGGAGGGTAGAGAAGGGACTTTGCTCGAGCAAAGTCCCTTCTCTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-876s1c1
Sequence:CCGGTGTGGTCAGCGAAGCGCTTAACTCGAGTTAAGCGCTTCGCTGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-294s1c1
Sequence:CCGGGGGATATAGCTTAAACCTAATCTCGAGATTAGGTTTAAGCTATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152742.1-647s21c1
Sequence:CCGGATGACACCCTGGCGGATTTCTCTCGAGAGAAATCCGCCAGGGTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152742.1-2165s21c1
Sequence:CCGGTATAGTCTCCAGCCCTCTAAGCTCGAGCTTAGAGGGCTGGAGACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-1148s1c1
Sequence:CCGGGTTTGATGTACCTGCAGGAAACTCGAGTTTCCTGCAGGTACATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152742.1-2492s1c1
Sequence:CCGGGAGTCCATGTTTATTCTGCAACTCGAGTTGCAGAATAAACATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-1686s1c1
Sequence:CCGGGCAGTATGCAGATGACTGGATCTCGAGATCCAGTCATCTGCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152742
GPC2 MISSION shRNA Lentiviral Transduction Particles
glypican 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152742.1-2004s21c1
Sequence:CCGGGAGGGTAGAGAAGGGACTTTGCTCGAGCAAAGTCCCTTCTCTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-876s1c1
Sequence:CCGGTGTGGTCAGCGAAGCGCTTAACTCGAGTTAAGCGCTTCGCTGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-294s1c1
Sequence:CCGGGGGATATAGCTTAAACCTAATCTCGAGATTAGGTTTAAGCTATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152742.1-647s21c1
Sequence:CCGGATGACACCCTGGCGGATTTCTCTCGAGAGAAATCCGCCAGGGTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152742.1-2165s21c1
Sequence:CCGGTATAGTCTCCAGCCCTCTAAGCTCGAGCTTAGAGGGCTGGAGACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-1148s1c1
Sequence:CCGGGTTTGATGTACCTGCAGGAAACTCGAGTTTCCTGCAGGTACATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152742.1-2492s1c1
Sequence:CCGGGAGTCCATGTTTATTCTGCAACTCGAGTTGCAGAATAAACATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152742.1-1686s1c1
Sequence:CCGGGCAGTATGCAGATGACTGGATCTCGAGATCCAGTCATCTGCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172412
GPC2 MISSION shRNA Bacterial Glycerol Stock
glypican 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172412.1-2252s1c1
Sequence:CCGGGCCTGTAAACCCATTATTCTTCTCGAGAAGAATAATGGGTTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-505s1c1
Sequence:CCGGGCATTCCTATGGTCGCCTGTACTCGAGTACAGGCGACCATAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-704s1c1
Sequence:CCGGCGGCTTACTTCAACTGCTGATCTCGAGATCAGCAGTTGAAGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-506s1c1
Sequence:CCGGCATTCCTATGGTCGCCTGTATCTCGAGATACAGGCGACCATAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-1097s1c1
Sequence:CCGGTCAGAAGGTTTGATGCACTTACTCGAGTAAGTGCATCAAACCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172412
GPC2 MISSION shRNA shRNA Plasmid DNA
glypican 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172412.1-2252s1c1
Sequence:CCGGGCCTGTAAACCCATTATTCTTCTCGAGAAGAATAATGGGTTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-505s1c1
Sequence:CCGGGCATTCCTATGGTCGCCTGTACTCGAGTACAGGCGACCATAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-704s1c1
Sequence:CCGGCGGCTTACTTCAACTGCTGATCTCGAGATCAGCAGTTGAAGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-506s1c1
Sequence:CCGGCATTCCTATGGTCGCCTGTATCTCGAGATACAGGCGACCATAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-1097s1c1
Sequence:CCGGTCAGAAGGTTTGATGCACTTACTCGAGTAAGTGCATCAAACCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172412
GPC2 MISSION shRNA Lentiviral Transduction Particles
glypican 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172412.1-2252s1c1
Sequence:CCGGGCCTGTAAACCCATTATTCTTCTCGAGAAGAATAATGGGTTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-505s1c1
Sequence:CCGGGCATTCCTATGGTCGCCTGTACTCGAGTACAGGCGACCATAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-704s1c1
Sequence:CCGGCGGCTTACTTCAACTGCTGATCTCGAGATCAGCAGTTGAAGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-506s1c1
Sequence:CCGGCATTCCTATGGTCGCCTGTATCTCGAGATACAGGCGACCATAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172412.1-1097s1c1
Sequence:CCGGTCAGAAGGTTTGATGCACTTACTCGAGTAAGTGCATCAAACCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks