EMAIL THIS PAGE TO A FRIEND

GPC3

glypican 3

95 Gene Product Result for
Synonyms: DGSX GTR2-2 MXR7 OCI-5 SDYS SGB SGBS SGBS1
UniProtKB ID: P51654, C9JLE3, G3V1R0, Q2L880, Q2L882
Gene ID:
Human(2719) Summary: Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The protein encoded by this gene can bind to and inhibit the dipeptidyl peptidase activity of CD26, and it can induce apoptosis in certain cell types. Deletion mutations in this gene are associated with Simpson-Golabi-Behmel syndrome, also known as Simpson dysmorphia syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(14734) glypican 3
Rat(25236) glypican 3
sheep(101119285) glypican 3
Zebrafish(387365) glypican 3
cow(615239) glypican 3
dog(481056) glypican 3
chicken(770863) glypican 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500115 Anti-Glypican-3 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP86, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB2108511 Anti-GPC3 IgG fraction of antiserum canine, horse, rabbit, guinea pig, mouse, canine, rat, pig, bovine
immunohistochemistry, western blot pricing
HPA006316 Anti-GPC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV37665 Anti-GPC3 antibody produced in rabbit IgG fraction of antiserum canine, rabbit, bovine, mouse, horse, rat, guinea pig, human
western blot pricing
SAB1402788 Monoclonal Anti-GPC3 antibody produced in mouse clone 2C12, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004484 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004484 Rosetta Predictions human pricing
NM_012774 Rosetta Predictions rat pricing
NM_016697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205845 predicted 1558
2 SASI_Hs01_00205846 predicted 1249
3 SASI_Hs01_00205847 predicted 793
4 SASI_Hs01_00205848 predicted 428
5 SASI_Hs01_00205849 predicted 1585
6 SASI_Hs01_00205850 predicted 750
7 SASI_Hs02_00337709 predicted 706
8 SASI_Hs01_00205851 predicted 1272
9 SASI_Hs01_00205852 predicted 954
10 SASI_Hs01_00205854 predicted 328
11 SASI_Hs01_00205853 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089246 predicted 1189
2 SASI_Rn01_00089247 predicted 1168
3 SASI_Rn01_00089248 predicted 1509
4 SASI_Rn02_00260171 predicted 921
5 SASI_Rn02_00260172 predicted 1186
6 SASI_Rn01_00089250 predicted 875
7 SASI_Rn01_00089251 predicted 592
8 SASI_Rn02_00260173 predicted 994
9 SASI_Rn01_00089253 predicted 960
10 SASI_Rn01_00089254 predicted 1282
11 SASI_Rn01_00089249 predicted 555
12 SASI_Rn01_00089252 predicted 363
13 SASI_Rn01_00089255 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159287 predicted 1176
2 SASI_Mm01_00159288 predicted 596
3 SASI_Mm01_00159289 predicted 885
4 SASI_Mm01_00159290 predicted 1024
5 SASI_Mm01_00159291 predicted 1202
6 SASI_Mm01_00159292 predicted 1001
7 SASI_Mm01_00159293 predicted 1427
8 SASI_Mm01_00159295 predicted 814
9 SASI_Mm02_00323360 predicted 578
10 SASI_Mm01_00159296 predicted 1574
11 SASI_Mm01_00159294 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004484
GPC3 MISSION shRNA Bacterial Glycerol Stock
glypican 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004484.2-2184s1c1
Sequence:CCGGGCCAAATTATTCTCCTATGTTCTCGAGAACATAGGAGAATAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-1713s1c1
Sequence:CCGGGCTCTGGTGATGGAATGATAACTCGAGTTATCATTCCATCACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-708s1c1
Sequence:CCGGGCCTGTTTCCAGTCATCTATACTCGAGTATAGATGACTGGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-1239s1c1
Sequence:CCGGCCCATTCTCAACAACGCCAATCTCGAGATTGGCGTTGTTGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-802s1c1
Sequence:CCGGCCTGAAAGTATTTGGGAATTTCTCGAGAAATTCCCAAATACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-708s21c1
Sequence:CCGGGCCTGTTTCCAGTCATCTATACTCGAGTATAGATGACTGGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-802s21c1
Sequence:CCGGCCTGAAAGTATTTGGGAATTTCTCGAGAAATTCCCAAATACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004484.2-2184s21c1
Sequence:CCGGGCCAAATTATTCTCCTATGTTCTCGAGAACATAGGAGAATAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-1239s21c1
Sequence:CCGGCCCATTCTCAACAACGCCAATCTCGAGATTGGCGTTGTTGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-1713s21c1
Sequence:CCGGGCTCTGGTGATGGAATGATAACTCGAGTTATCATTCCATCACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004484
GPC3 MISSION shRNA shRNA Plasmid DNA
glypican 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004484.2-2184s1c1
Sequence:CCGGGCCAAATTATTCTCCTATGTTCTCGAGAACATAGGAGAATAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-1713s1c1
Sequence:CCGGGCTCTGGTGATGGAATGATAACTCGAGTTATCATTCCATCACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-708s1c1
Sequence:CCGGGCCTGTTTCCAGTCATCTATACTCGAGTATAGATGACTGGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-1239s1c1
Sequence:CCGGCCCATTCTCAACAACGCCAATCTCGAGATTGGCGTTGTTGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-802s1c1
Sequence:CCGGCCTGAAAGTATTTGGGAATTTCTCGAGAAATTCCCAAATACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-708s21c1
Sequence:CCGGGCCTGTTTCCAGTCATCTATACTCGAGTATAGATGACTGGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-802s21c1
Sequence:CCGGCCTGAAAGTATTTGGGAATTTCTCGAGAAATTCCCAAATACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004484.2-2184s21c1
Sequence:CCGGGCCAAATTATTCTCCTATGTTCTCGAGAACATAGGAGAATAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-1239s21c1
Sequence:CCGGCCCATTCTCAACAACGCCAATCTCGAGATTGGCGTTGTTGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-1713s21c1
Sequence:CCGGGCTCTGGTGATGGAATGATAACTCGAGTTATCATTCCATCACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004484
GPC3 MISSION shRNA Lentiviral Transduction Particles
glypican 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004484.2-2184s1c1
Sequence:CCGGGCCAAATTATTCTCCTATGTTCTCGAGAACATAGGAGAATAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-1713s1c1
Sequence:CCGGGCTCTGGTGATGGAATGATAACTCGAGTTATCATTCCATCACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-708s1c1
Sequence:CCGGGCCTGTTTCCAGTCATCTATACTCGAGTATAGATGACTGGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-1239s1c1
Sequence:CCGGCCCATTCTCAACAACGCCAATCTCGAGATTGGCGTTGTTGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004484.2-802s1c1
Sequence:CCGGCCTGAAAGTATTTGGGAATTTCTCGAGAAATTCCCAAATACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-708s21c1
Sequence:CCGGGCCTGTTTCCAGTCATCTATACTCGAGTATAGATGACTGGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-802s21c1
Sequence:CCGGCCTGAAAGTATTTGGGAATTTCTCGAGAAATTCCCAAATACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004484.2-2184s21c1
Sequence:CCGGGCCAAATTATTCTCCTATGTTCTCGAGAACATAGGAGAATAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-1239s21c1
Sequence:CCGGCCCATTCTCAACAACGCCAATCTCGAGATTGGCGTTGTTGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004484.2-1713s21c1
Sequence:CCGGGCTCTGGTGATGGAATGATAACTCGAGTTATCATTCCATCACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016697
VALIDATED
GPC3 MISSION shRNA Bacterial Glycerol Stock
glypican 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016697.2-1974s1c1
Sequence:CCGGCCACCATTAAGTAGGAGACTACTCGAGTAGTCTCCTACTTAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016697.2-332s1c1
Sequence:CCGGGCTCAAGAAAGATGGAAGAAACTCGAGTTTCTTCCATCTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016697.2-492s1c1
Sequence:CCGGCAACGCCATGTTCAAGAATAACTCGAGTTATTCTTGAACATGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016697.2-1178s1c1
Sequence:CCGGGCCAATATAGATCTGCTTATTCTCGAGAATAAGCAGATCTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016697.2-808s1c1
Sequence:CCGGGCCCTGAATCTCGGAATTGAACTCGAGTTCAATTCCGAGATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016697.2-808s21c1
Sequence:CCGGGCCCTGAATCTCGGAATTGAACTCGAGTTCAATTCCGAGATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016697.2-2029s21c1
Sequence:CCGGCTTTATGAGGATGGTAAATTTCTCGAGAAATTTACCATCCTCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016697.2-538s21c1
Sequence:CCGGTTTGAGTTTGTCGGTGAATTTCTCGAGAAATTCACCGACAAACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016697.2-332s21c1
Sequence:CCGGGCTCAAGAAAGATGGAAGAAACTCGAGTTTCTTCCATCTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016697.2-492s21c1
Sequence:CCGGCAACGCCATGTTCAAGAATAACTCGAGTTATTCTTGAACATGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016697
VALIDATED
GPC3 MISSION shRNA shRNA Plasmid DNA
glypican 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016697.2-1974s1c1
Sequence:CCGGCCACCATTAAGTAGGAGACTACTCGAGTAGTCTCCTACTTAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016697.2-332s1c1
Sequence:CCGGGCTCAAGAAAGATGGAAGAAACTCGAGTTTCTTCCATCTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016697.2-492s1c1
Sequence:CCGGCAACGCCATGTTCAAGAATAACTCGAGTTATTCTTGAACATGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016697.2-1178s1c1
Sequence:CCGGGCCAATATAGATCTGCTTATTCTCGAGAATAAGCAGATCTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016697.2-808s1c1
Sequence:CCGGGCCCTGAATCTCGGAATTGAACTCGAGTTCAATTCCGAGATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016697.2-808s21c1
Sequence:CCGGGCCCTGAATCTCGGAATTGAACTCGAGTTCAATTCCGAGATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016697.2-2029s21c1
Sequence:CCGGCTTTATGAGGATGGTAAATTTCTCGAGAAATTTACCATCCTCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016697.2-538s21c1
Sequence:CCGGTTTGAGTTTGTCGGTGAATTTCTCGAGAAATTCACCGACAAACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016697.2-332s21c1
Sequence:CCGGGCTCAAGAAAGATGGAAGAAACTCGAGTTTCTTCCATCTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016697.2-492s21c1
Sequence:CCGGCAACGCCATGTTCAAGAATAACTCGAGTTATTCTTGAACATGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016697
VALIDATED
GPC3 MISSION shRNA Lentiviral Transduction Particles
glypican 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016697.2-1974s1c1
Sequence:CCGGCCACCATTAAGTAGGAGACTACTCGAGTAGTCTCCTACTTAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016697.2-332s1c1
Sequence:CCGGGCTCAAGAAAGATGGAAGAAACTCGAGTTTCTTCCATCTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016697.2-492s1c1
Sequence:CCGGCAACGCCATGTTCAAGAATAACTCGAGTTATTCTTGAACATGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016697.2-1178s1c1
Sequence:CCGGGCCAATATAGATCTGCTTATTCTCGAGAATAAGCAGATCTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016697.2-808s1c1
Sequence:CCGGGCCCTGAATCTCGGAATTGAACTCGAGTTCAATTCCGAGATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016697.2-808s21c1
Sequence:CCGGGCCCTGAATCTCGGAATTGAACTCGAGTTCAATTCCGAGATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016697.2-2029s21c1
Sequence:CCGGCTTTATGAGGATGGTAAATTTCTCGAGAAATTTACCATCCTCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016697.2-538s21c1
Sequence:CCGGTTTGAGTTTGTCGGTGAATTTCTCGAGAAATTCACCGACAAACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016697.2-332s21c1
Sequence:CCGGGCTCAAGAAAGATGGAAGAAACTCGAGTTTCTTCCATCTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016697.2-492s21c1
Sequence:CCGGCAACGCCATGTTCAAGAATAACTCGAGTTATTCTTGAACATGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks