EMAIL THIS PAGE TO A FRIEND

GPC4

glypican 4

122 Gene Product Result for
Synonyms: K-glypican
Gene ID:
Human(2239) Summary: Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The GPC4 gene is adjacent to the 3' end of GPC3 and may also play a role in Simpson-Golabi-Behmel syndrome. [provided by RefSeq, Jul 2008]
Mouse(14735) glypican 4
Rat(317322) glypican 4
Zebrafish(118437) glypican 4
cow(540179) glypican 4
Horse(100057156) glypican 4
dog(492144) glypican 4
chicken(422234) glypican 4
sheep(101109518) glypican 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001448 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130121 MISSION® esiRNA esiRNA human GPC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001448 Rosetta Predictions human pricing
NM_001014108 Rosetta Predictions rat pricing
NM_008150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154321 predicted 556
2 SASI_Hs01_00154322 predicted 648
3 SASI_Hs02_00331875 predicted 861
4 SASI_Hs01_00154323 predicted 482
5 SASI_Hs01_00154324 predicted 355
6 SASI_Hs01_00154325 predicted 1122
7 SASI_Hs01_00154326 predicted 1733
8 SASI_Hs01_00154327 predicted 809
9 SASI_Hs01_00154328 predicted 1632
10 SASI_Hs01_00154330 predicted 585
11 SASI_Hs01_00154329 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201549 predicted 1463
2 SASI_Rn01_00112801 predicted 957
3 SASI_Rn01_00112802 predicted 1300
4 SASI_Rn01_00112803 predicted 1291
5 SASI_Rn01_00112804 predicted 864
6 SASI_Rn01_00112805 predicted 813
7 SASI_Rn02_00201550 predicted 1183
8 SASI_Rn01_00112807 predicted 1938
9 SASI_Rn01_00112809 predicted 1774
10 SASI_Rn01_00112810 predicted 1431
11 SASI_Rn01_00112806 predicted 1630
12 SASI_Rn01_00112808 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040041 predicted 1139
2 SASI_Mm01_00040042 predicted 1246
3 SASI_Mm01_00040044 predicted 1910
4 SASI_Mm01_00040045 predicted 819
5 SASI_Mm02_00313249 predicted 1287
6 SASI_Mm01_00040046 predicted 1436
7 SASI_Mm01_00040047 predicted 842
8 SASI_Mm01_00040048 predicted 1556
9 SASI_Mm01_00040049 predicted 1886
10 SASI_Mm01_00040050 predicted 1444
11 SASI_Mm01_00040043 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008150
VALIDATED
GPC4 MISSION shRNA Bacterial Glycerol Stock
glypican 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.2-826s21c1
Sequence:CCGGAGTTGCAAGGGATGTAGTAAGCTCGAGCTTACTACATCCCTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-911s21c1
Sequence:CCGGCGCTACTATGTGGCGGGAAATCTCGAGATTTCCCGCCACATAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-815s21c1
Sequence:CCGGGCAGAGAAATCCCTGAATGATCTCGAGATCATTCAGGGATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-764s21c1
Sequence:CCGGGCATCCCGTTACAAGAAGTTTCTCGAGAAACTTCTTGTAACGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-2279s21c1
Sequence:CCGGGCCACTGGTTTAAGCAATGTTCTCGAGAACATTGCTTAAACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008150.1-2279s1c1
Sequence:CCGGGCCACTGGTTTAAGCAATGTTCTCGAGAACATTGCTTAAACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008150.1-764s1c1
Sequence:CCGGGCATCCCGTTACAAGAAGTTTCTCGAGAAACTTCTTGTAACGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008150.1-815s1c1
Sequence:CCGGGCAGAGAAATCCCTGAATGATCTCGAGATCATTCAGGGATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008150.1-1871s1c1
Sequence:CCGGCTTCGGGTTATGACCAGTAAACTCGAGTTTACTGGTCATAACCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008150.1-1382s1c1
Sequence:CCGGCCTTTCAACATTGAGTCCGTTCTCGAGAACGGACTCAATGTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008150
VALIDATED
GPC4 MISSION shRNA shRNA Plasmid DNA
glypican 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.2-826s21c1
Sequence:CCGGAGTTGCAAGGGATGTAGTAAGCTCGAGCTTACTACATCCCTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-911s21c1
Sequence:CCGGCGCTACTATGTGGCGGGAAATCTCGAGATTTCCCGCCACATAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-815s21c1
Sequence:CCGGGCAGAGAAATCCCTGAATGATCTCGAGATCATTCAGGGATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-764s21c1
Sequence:CCGGGCATCCCGTTACAAGAAGTTTCTCGAGAAACTTCTTGTAACGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-2279s21c1
Sequence:CCGGGCCACTGGTTTAAGCAATGTTCTCGAGAACATTGCTTAAACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008150.1-2279s1c1
Sequence:CCGGGCCACTGGTTTAAGCAATGTTCTCGAGAACATTGCTTAAACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008150.1-764s1c1
Sequence:CCGGGCATCCCGTTACAAGAAGTTTCTCGAGAAACTTCTTGTAACGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008150.1-815s1c1
Sequence:CCGGGCAGAGAAATCCCTGAATGATCTCGAGATCATTCAGGGATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008150.1-1871s1c1
Sequence:CCGGCTTCGGGTTATGACCAGTAAACTCGAGTTTACTGGTCATAACCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008150.1-1382s1c1
Sequence:CCGGCCTTTCAACATTGAGTCCGTTCTCGAGAACGGACTCAATGTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008150
VALIDATED
GPC4 MISSION shRNA Lentiviral Transduction Particles
glypican 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.2-826s21c1
Sequence:CCGGAGTTGCAAGGGATGTAGTAAGCTCGAGCTTACTACATCCCTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-911s21c1
Sequence:CCGGCGCTACTATGTGGCGGGAAATCTCGAGATTTCCCGCCACATAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-815s21c1
Sequence:CCGGGCAGAGAAATCCCTGAATGATCTCGAGATCATTCAGGGATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-764s21c1
Sequence:CCGGGCATCCCGTTACAAGAAGTTTCTCGAGAAACTTCTTGTAACGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008150.1-2279s21c1
Sequence:CCGGGCCACTGGTTTAAGCAATGTTCTCGAGAACATTGCTTAAACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008150.1-2279s1c1
Sequence:CCGGGCCACTGGTTTAAGCAATGTTCTCGAGAACATTGCTTAAACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008150.1-764s1c1
Sequence:CCGGGCATCCCGTTACAAGAAGTTTCTCGAGAAACTTCTTGTAACGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008150.1-815s1c1
Sequence:CCGGGCAGAGAAATCCCTGAATGATCTCGAGATCATTCAGGGATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008150.1-1871s1c1
Sequence:CCGGCTTCGGGTTATGACCAGTAAACTCGAGTTTACTGGTCATAACCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008150.1-1382s1c1
Sequence:CCGGCCTTTCAACATTGAGTCCGTTCTCGAGAACGGACTCAATGTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001448
GPC4 MISSION shRNA Bacterial Glycerol Stock
glypican 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001448.2-473s21c1
Sequence:CCGGCAGCGAACAGTGCAATCATTTCTCGAGAAATGATTGCACTGTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001448.2-1586s21c1
Sequence:CCGGCATACTGATCCTTCGTCAAATCTCGAGATTTGACGAAGGATCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-507s1c1
Sequence:CCGGGCTTCACGTTACAAGAAGTTTCTCGAGAAACTTCTTGTAACGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001448.2-1005s1c1
Sequence:CCGGCCATGTTACAACTACTGCTCACTCGAGTGAGCAGTAGTTGTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-1734s1c1
Sequence:CCGGCCTTCAGAGTTTGACTACAATCTCGAGATTGTAGTCAAACTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-439s1c1
Sequence:CCGGGCCTGCAAAGTAAAGATGATTCTCGAGAATCATCTTTACTTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-1176s1c1
Sequence:CCGGGCTATTATGAACATGCAGGATCTCGAGATCCTGCATGTTCATAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-826s1c1
Sequence:CCGGGCAAATTGAAGCTCCAGGTTACTCGAGTAACCTGGAGCTTCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001448
GPC4 MISSION shRNA shRNA Plasmid DNA
glypican 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001448.2-473s21c1
Sequence:CCGGCAGCGAACAGTGCAATCATTTCTCGAGAAATGATTGCACTGTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001448.2-1586s21c1
Sequence:CCGGCATACTGATCCTTCGTCAAATCTCGAGATTTGACGAAGGATCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-507s1c1
Sequence:CCGGGCTTCACGTTACAAGAAGTTTCTCGAGAAACTTCTTGTAACGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001448.2-1005s1c1
Sequence:CCGGCCATGTTACAACTACTGCTCACTCGAGTGAGCAGTAGTTGTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-1734s1c1
Sequence:CCGGCCTTCAGAGTTTGACTACAATCTCGAGATTGTAGTCAAACTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-439s1c1
Sequence:CCGGGCCTGCAAAGTAAAGATGATTCTCGAGAATCATCTTTACTTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-1176s1c1
Sequence:CCGGGCTATTATGAACATGCAGGATCTCGAGATCCTGCATGTTCATAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-826s1c1
Sequence:CCGGGCAAATTGAAGCTCCAGGTTACTCGAGTAACCTGGAGCTTCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001448
GPC4 MISSION shRNA Lentiviral Transduction Particles
glypican 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001448.2-473s21c1
Sequence:CCGGCAGCGAACAGTGCAATCATTTCTCGAGAAATGATTGCACTGTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001448.2-1586s21c1
Sequence:CCGGCATACTGATCCTTCGTCAAATCTCGAGATTTGACGAAGGATCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-507s1c1
Sequence:CCGGGCTTCACGTTACAAGAAGTTTCTCGAGAAACTTCTTGTAACGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001448.2-1005s1c1
Sequence:CCGGCCATGTTACAACTACTGCTCACTCGAGTGAGCAGTAGTTGTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-1734s1c1
Sequence:CCGGCCTTCAGAGTTTGACTACAATCTCGAGATTGTAGTCAAACTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-439s1c1
Sequence:CCGGGCCTGCAAAGTAAAGATGATTCTCGAGAATCATCTTTACTTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-1176s1c1
Sequence:CCGGGCTATTATGAACATGCAGGATCTCGAGATCCTGCATGTTCATAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001448.2-826s1c1
Sequence:CCGGGCAAATTGAAGCTCCAGGTTACTCGAGTAACCTGGAGCTTCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks