EMAIL THIS PAGE TO A FRIEND

GPC5

glypican 5

106 Gene Product Result for
UniProtKB ID: P78333, B2R726, O60436, Q9BX27
Gene ID:
Human(2262) Summary: Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
Mouse(103978) glypican 5
Rat(306157) glypican 5
sheep(101106341) glypican 5
Zebrafish(571278) glypican 5
chicken(418795) glypican 5
cow(522828) glypican 5
Horse(100058273) glypican 5
dog(485518) glypican 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004466 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034601 MISSION® esiRNA esiRNA human GPC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004466 Rosetta Predictions human pricing
NM_001107285 Rosetta Predictions rat pricing
NM_175500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064033 predicted 1816
2 SASI_Hs02_00337669 predicted 1092
3 SASI_Hs02_00337670 predicted 838
4 SASI_Hs02_00337671 predicted 1102
5 SASI_Hs01_00064035 predicted 583
6 SASI_Hs01_00064036 predicted 1994
7 SASI_Hs01_00064037 predicted 1411
8 SASI_Hs01_00064039 predicted 2055
9 SASI_Hs01_00064040 predicted 2060
10 SASI_Hs01_00064041 predicted 2157
11 SASI_Hs01_00064034 predicted 2142
12 SASI_Hs01_00064038 predicted 666
13 SASI_Hs01_00064042 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227335 predicted 1379
2 SASI_Rn02_00227336 predicted 894
3 SASI_Rn02_00227337 predicted 1090
4 SASI_Rn02_00227338 predicted 932
5 SASI_Rn02_00227339 predicted 852
6 SASI_Rn02_00227340 predicted 725
7 SASI_Rn02_00227341 predicted 730
8 SASI_Rn02_00227342 predicted 636
9 SASI_Rn02_00227343 predicted 1037
10 SASI_Rn02_00227344 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104013 predicted 931
2 SASI_Mm01_00104014 predicted 1363
3 SASI_Mm01_00104015 predicted 2129
4 SASI_Mm02_00346412 predicted 836
5 SASI_Mm01_00104016 predicted 718
6 SASI_Mm01_00104018 predicted 1731
7 SASI_Mm01_00104019 predicted 922
8 SASI_Mm01_00104020 predicted 1919
9 SASI_Mm01_00104021 predicted 973
10 SASI_Mm01_00104022 predicted 659
11 SASI_Mm01_00104017 predicted 2109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004466
GPC5 MISSION shRNA Bacterial Glycerol Stock
glypican 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004466.3-2373s1c1
Sequence:CCGGGCACAGAAGTGACTTTGAATACTCGAGTATTCAAAGTCACTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004466.3-854s1c1
Sequence:CCGGCGGATGTTAATCCTGAAGAATCTCGAGATTCTTCAGGATTAACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004466.3-2562s1c1
Sequence:CCGGGCAAGTAGTATGCATGCATATCTCGAGATATGCATGCATACTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004466.3-2170s1c1
Sequence:CCGGGCCTGGAATAAGAGATCCTTTCTCGAGAAAGGATCTCTTATTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004466.4-1714s21c1
Sequence:CCGGGGAATTGATCCTGTGATAAATCTCGAGATTTATCACAGGATCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004466.4-2108s21c1
Sequence:CCGGACCTTACTGAAGTCTCGATTTCTCGAGAAATCGAGACTTCAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004466.4-2023s21c1
Sequence:CCGGGCGACTGAATCTATGACATTCCTCGAGGAATGTCATAGATTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004466.4-967s21c1
Sequence:CCGGGTGAGTCCATTTGGTAATATTCTCGAGAATATTACCAAATGGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004466
GPC5 MISSION shRNA shRNA Plasmid DNA
glypican 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004466.3-2373s1c1
Sequence:CCGGGCACAGAAGTGACTTTGAATACTCGAGTATTCAAAGTCACTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004466.3-854s1c1
Sequence:CCGGCGGATGTTAATCCTGAAGAATCTCGAGATTCTTCAGGATTAACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004466.3-2562s1c1
Sequence:CCGGGCAAGTAGTATGCATGCATATCTCGAGATATGCATGCATACTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004466.3-2170s1c1
Sequence:CCGGGCCTGGAATAAGAGATCCTTTCTCGAGAAAGGATCTCTTATTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004466.4-1714s21c1
Sequence:CCGGGGAATTGATCCTGTGATAAATCTCGAGATTTATCACAGGATCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004466.4-2108s21c1
Sequence:CCGGACCTTACTGAAGTCTCGATTTCTCGAGAAATCGAGACTTCAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004466.4-2023s21c1
Sequence:CCGGGCGACTGAATCTATGACATTCCTCGAGGAATGTCATAGATTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004466.4-967s21c1
Sequence:CCGGGTGAGTCCATTTGGTAATATTCTCGAGAATATTACCAAATGGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004466
GPC5 MISSION shRNA Lentiviral Transduction Particles
glypican 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004466.3-2373s1c1
Sequence:CCGGGCACAGAAGTGACTTTGAATACTCGAGTATTCAAAGTCACTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004466.3-854s1c1
Sequence:CCGGCGGATGTTAATCCTGAAGAATCTCGAGATTCTTCAGGATTAACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004466.3-2562s1c1
Sequence:CCGGGCAAGTAGTATGCATGCATATCTCGAGATATGCATGCATACTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004466.3-2170s1c1
Sequence:CCGGGCCTGGAATAAGAGATCCTTTCTCGAGAAAGGATCTCTTATTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004466.4-1714s21c1
Sequence:CCGGGGAATTGATCCTGTGATAAATCTCGAGATTTATCACAGGATCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004466.4-2108s21c1
Sequence:CCGGACCTTACTGAAGTCTCGATTTCTCGAGAAATCGAGACTTCAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004466.4-2023s21c1
Sequence:CCGGGCGACTGAATCTATGACATTCCTCGAGGAATGTCATAGATTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004466.4-967s21c1
Sequence:CCGGGTGAGTCCATTTGGTAATATTCTCGAGAATATTACCAAATGGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175500
GPC5 MISSION shRNA Bacterial Glycerol Stock
glypican 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175500.2-2670s1c1
Sequence:CCGGCCTCCTCTACTGATCTTAGTACTCGAGTACTAAGATCAGTAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-654s1c1
Sequence:CCGGGCTCAACATTAAAGTTGCTAACTCGAGTTAGCAACTTTAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-968s1c1
Sequence:CCGGCGCCAGGATGTTAGTCCATTTCTCGAGAAATGGACTAACATCCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-840s1c1
Sequence:CCGGCGGATGTTAATCCCGAGGAATCTCGAGATTCCTCGGGATTAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-465s1c1
Sequence:CCGGGCGAAGAAGTTCGGAAACTTTCTCGAGAAAGTTTCCGAACTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175500.4-847s21c1
Sequence:CCGGACGGATGTTGGACTCTATTTACTCGAGTAAATAGAGTCCAACATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175500.4-2490s21c1
Sequence:CCGGCAGAACACAATAAGTAGTATTCTCGAGAATACTACTTATTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175500.4-2449s21c1
Sequence:CCGGACATTGTGAATGTCGACATTTCTCGAGAAATGTCGACATTCACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175500.4-2548s21c1
Sequence:CCGGAGCACAGAAAGGCAAGTATTACTCGAGTAATACTTGCCTTTCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175500
GPC5 MISSION shRNA shRNA Plasmid DNA
glypican 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175500.2-2670s1c1
Sequence:CCGGCCTCCTCTACTGATCTTAGTACTCGAGTACTAAGATCAGTAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-654s1c1
Sequence:CCGGGCTCAACATTAAAGTTGCTAACTCGAGTTAGCAACTTTAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-968s1c1
Sequence:CCGGCGCCAGGATGTTAGTCCATTTCTCGAGAAATGGACTAACATCCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-840s1c1
Sequence:CCGGCGGATGTTAATCCCGAGGAATCTCGAGATTCCTCGGGATTAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-465s1c1
Sequence:CCGGGCGAAGAAGTTCGGAAACTTTCTCGAGAAAGTTTCCGAACTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175500.4-847s21c1
Sequence:CCGGACGGATGTTGGACTCTATTTACTCGAGTAAATAGAGTCCAACATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175500.4-2490s21c1
Sequence:CCGGCAGAACACAATAAGTAGTATTCTCGAGAATACTACTTATTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175500.4-2449s21c1
Sequence:CCGGACATTGTGAATGTCGACATTTCTCGAGAAATGTCGACATTCACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175500.4-2548s21c1
Sequence:CCGGAGCACAGAAAGGCAAGTATTACTCGAGTAATACTTGCCTTTCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175500
GPC5 MISSION shRNA Lentiviral Transduction Particles
glypican 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175500.2-2670s1c1
Sequence:CCGGCCTCCTCTACTGATCTTAGTACTCGAGTACTAAGATCAGTAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-654s1c1
Sequence:CCGGGCTCAACATTAAAGTTGCTAACTCGAGTTAGCAACTTTAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-968s1c1
Sequence:CCGGCGCCAGGATGTTAGTCCATTTCTCGAGAAATGGACTAACATCCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-840s1c1
Sequence:CCGGCGGATGTTAATCCCGAGGAATCTCGAGATTCCTCGGGATTAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175500.2-465s1c1
Sequence:CCGGGCGAAGAAGTTCGGAAACTTTCTCGAGAAAGTTTCCGAACTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175500.4-847s21c1
Sequence:CCGGACGGATGTTGGACTCTATTTACTCGAGTAAATAGAGTCCAACATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175500.4-2490s21c1
Sequence:CCGGCAGAACACAATAAGTAGTATTCTCGAGAATACTACTTATTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175500.4-2449s21c1
Sequence:CCGGACATTGTGAATGTCGACATTTCTCGAGAAATGTCGACATTCACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175500.4-2548s21c1
Sequence:CCGGAGCACAGAAAGGCAAGTATTACTCGAGTAATACTTGCCTTTCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks