EMAIL THIS PAGE TO A FRIEND

GPC6

glypican 6

109 Gene Product Result for
Synonyms: OMIMD1
UniProtKB ID: Q9Y625, A8K279, Q96SG5, Q96SG8, Q9H1P4
Gene ID:
Human(10082) Summary: The glypicans comprise a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans, and they have been implicated in the control of cell growth and cell division. The glypican encoded by this gene is a putative cell surface coreceptor for growth factors, extracellular matrix proteins, proteases and anti-proteases. [provided by RefSeq, Jan 2009]
Mouse(23888) glypican 6
cow(536153) glypican 6
Horse(100058693) glypican 6
dog(476962) glypican 6
chicken(418794) glypican 6
sheep(101106600) glypican 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005708 Rosetta Predictions human pricing
NM_001079844 Rosetta Predictions mouse pricing
NM_011821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064861 predicted 2017
2 SASI_Hs01_00064862 predicted 1571
3 SASI_Hs01_00064864 predicted 2356
4 SASI_Hs01_00064865 predicted 2356
5 SASI_Hs01_00064866 predicted 1474
6 SASI_Hs02_00340125 predicted 1731
7 SASI_Hs02_00340126 predicted 1900
8 SASI_Hs02_00340127 predicted 1339
9 SASI_Hs01_00064867 predicted 2066
10 SASI_Hs01_00064869 predicted 909
11 SASI_Hs01_00064860 predicted 1136
12 SASI_Hs01_00064863 predicted 1126
13 SASI_Hs01_00064868 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293092 predicted 2085
2 SASI_Mm02_00293093 predicted 893
3 SASI_Mm02_00293094 predicted 1027
4 SASI_Mm02_00293095 predicted 887
5 SASI_Mm02_00293096 predicted 2045
6 SASI_Mm02_00293097 predicted 1463
7 SASI_Mm02_00293098 predicted 2107
8 SASI_Mm02_00293099 predicted 1131
9 SASI_Mm02_00293100 predicted 1146
10 SASI_Mm02_00293101 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321527 predicted 2057
2 SASI_Mm01_00105852 predicted 889
3 SASI_Mm01_00105853 predicted 1027
4 SASI_Mm02_00321528 predicted 890
5 SASI_Mm01_00105855 predicted 2015
6 SASI_Mm01_00105854 predicted 1461
7 SASI_Mm01_00105857 predicted 2076
8 SASI_Mm01_00105859 predicted 1128
9 SASI_Mm01_00105860 predicted 1145
10 SASI_Mm01_00105861 predicted 906
11 SASI_Mm01_00105856 predicted 1328
12 SASI_Mm01_00105858 predicted 1652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005708
GPC6 MISSION shRNA Bacterial Glycerol Stock
glypican 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-1717s21c1
Sequence:CCGGCACGTTTCAGGCCCTACAATCCTCGAGGATTGTAGGGCCTGAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-2007s21c1
Sequence:CCGGTTCATCAGACAGCAGATTATGCTCGAGCATAATCTGCTGTCTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-1319s21c1
Sequence:CCGGAGAAGTTGCAAACCGAGTTTCCTCGAGGAAACTCGGTTTGCAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-1142s21c1
Sequence:CCGGACGGATGTTTCAGCTGATAAACTCGAGTTTATCAGCTGAAACATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-1890s1c1
Sequence:CCGGGCACAGCAAAGCCAGATACTTCTCGAGAAGTATCTGGCTTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-842s1c1
Sequence:CCGGGCCAACAAAGCAAACTCGAATCTCGAGATTCGAGTTTGCTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-1579s1c1
Sequence:CCGGGCCATTATGAACATGCAAGAACTCGAGTTCTTGCATGTTCATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005708.2-2468s1c1
Sequence:CCGGGCTTCCTCTTTCCTTCAGCTACTCGAGTAGCTGAAGGAAAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-1553s1c1
Sequence:CCGGACCCGATAGATGTCAAGATTTCTCGAGAAATCTTGACATCTATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005708
GPC6 MISSION shRNA shRNA Plasmid DNA
glypican 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-1717s21c1
Sequence:CCGGCACGTTTCAGGCCCTACAATCCTCGAGGATTGTAGGGCCTGAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-2007s21c1
Sequence:CCGGTTCATCAGACAGCAGATTATGCTCGAGCATAATCTGCTGTCTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-1319s21c1
Sequence:CCGGAGAAGTTGCAAACCGAGTTTCCTCGAGGAAACTCGGTTTGCAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-1142s21c1
Sequence:CCGGACGGATGTTTCAGCTGATAAACTCGAGTTTATCAGCTGAAACATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-1890s1c1
Sequence:CCGGGCACAGCAAAGCCAGATACTTCTCGAGAAGTATCTGGCTTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-842s1c1
Sequence:CCGGGCCAACAAAGCAAACTCGAATCTCGAGATTCGAGTTTGCTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-1579s1c1
Sequence:CCGGGCCATTATGAACATGCAAGAACTCGAGTTCTTGCATGTTCATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005708.2-2468s1c1
Sequence:CCGGGCTTCCTCTTTCCTTCAGCTACTCGAGTAGCTGAAGGAAAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-1553s1c1
Sequence:CCGGACCCGATAGATGTCAAGATTTCTCGAGAAATCTTGACATCTATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005708
GPC6 MISSION shRNA Lentiviral Transduction Particles
glypican 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-1717s21c1
Sequence:CCGGCACGTTTCAGGCCCTACAATCCTCGAGGATTGTAGGGCCTGAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-2007s21c1
Sequence:CCGGTTCATCAGACAGCAGATTATGCTCGAGCATAATCTGCTGTCTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-1319s21c1
Sequence:CCGGAGAAGTTGCAAACCGAGTTTCCTCGAGGAAACTCGGTTTGCAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005708.3-1142s21c1
Sequence:CCGGACGGATGTTTCAGCTGATAAACTCGAGTTTATCAGCTGAAACATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-1890s1c1
Sequence:CCGGGCACAGCAAAGCCAGATACTTCTCGAGAAGTATCTGGCTTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-842s1c1
Sequence:CCGGGCCAACAAAGCAAACTCGAATCTCGAGATTCGAGTTTGCTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-1579s1c1
Sequence:CCGGGCCATTATGAACATGCAAGAACTCGAGTTCTTGCATGTTCATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005708.2-2468s1c1
Sequence:CCGGGCTTCCTCTTTCCTTCAGCTACTCGAGTAGCTGAAGGAAAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005708.2-1553s1c1
Sequence:CCGGACCCGATAGATGTCAAGATTTCTCGAGAAATCTTGACATCTATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011821
VALIDATED
GPC6 MISSION shRNA Bacterial Glycerol Stock
glypican 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-1547s21c1
Sequence:CCGGAGTCAGTCATGGACCCAATAGCTCGAGCTATTGGGTCCATGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-1308s21c1
Sequence:CCGGAGAGGTTGCCAACCGAGTTTCCTCGAGGAAACTCGGTTGGCAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-1132s21c1
Sequence:CCGGAGGATGTTCCAGCTGATTAACCTCGAGGTTAATCAGCTGGAACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-795s21c1
Sequence:CCGGCATCTGCCCTCAGGAATATACCTCGAGGTATATTCCTGAGGGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-1761s1c1
Sequence:CCGGCTCCGTGTGATGACCAACAAACTCGAGTTTGTTGGTCATCACACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-591s1c1
Sequence:CCGGCAACAGAGTAAACTGGAGTTTCTCGAGAAACTCCAGTTTACTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-1327s1c1
Sequence:CCGGCCATTATGAACATGCAGGAAACTCGAGTTTCCTGCATGTTCATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-881s1c1
Sequence:CCGGCCAGCTGATTAACCCTCAGTACTCGAGTACTGAGGGTTAATCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011821.1-2244s1c1
Sequence:CCGGCCTCGTTTATTCCAGAGAGAACTCGAGTTCTCTCTGGAATAAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011821
VALIDATED
GPC6 MISSION shRNA shRNA Plasmid DNA
glypican 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-1547s21c1
Sequence:CCGGAGTCAGTCATGGACCCAATAGCTCGAGCTATTGGGTCCATGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-1308s21c1
Sequence:CCGGAGAGGTTGCCAACCGAGTTTCCTCGAGGAAACTCGGTTGGCAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-1132s21c1
Sequence:CCGGAGGATGTTCCAGCTGATTAACCTCGAGGTTAATCAGCTGGAACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-795s21c1
Sequence:CCGGCATCTGCCCTCAGGAATATACCTCGAGGTATATTCCTGAGGGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-1761s1c1
Sequence:CCGGCTCCGTGTGATGACCAACAAACTCGAGTTTGTTGGTCATCACACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-591s1c1
Sequence:CCGGCAACAGAGTAAACTGGAGTTTCTCGAGAAACTCCAGTTTACTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-1327s1c1
Sequence:CCGGCCATTATGAACATGCAGGAAACTCGAGTTTCCTGCATGTTCATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-881s1c1
Sequence:CCGGCCAGCTGATTAACCCTCAGTACTCGAGTACTGAGGGTTAATCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011821.1-2244s1c1
Sequence:CCGGCCTCGTTTATTCCAGAGAGAACTCGAGTTCTCTCTGGAATAAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011821
VALIDATED
GPC6 MISSION shRNA Lentiviral Transduction Particles
glypican 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-1547s21c1
Sequence:CCGGAGTCAGTCATGGACCCAATAGCTCGAGCTATTGGGTCCATGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-1308s21c1
Sequence:CCGGAGAGGTTGCCAACCGAGTTTCCTCGAGGAAACTCGGTTGGCAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-1132s21c1
Sequence:CCGGAGGATGTTCCAGCTGATTAACCTCGAGGTTAATCAGCTGGAACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011821.2-795s21c1
Sequence:CCGGCATCTGCCCTCAGGAATATACCTCGAGGTATATTCCTGAGGGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-1761s1c1
Sequence:CCGGCTCCGTGTGATGACCAACAAACTCGAGTTTGTTGGTCATCACACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-591s1c1
Sequence:CCGGCAACAGAGTAAACTGGAGTTTCTCGAGAAACTCCAGTTTACTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-1327s1c1
Sequence:CCGGCCATTATGAACATGCAGGAAACTCGAGTTTCCTGCATGTTCATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011821.1-881s1c1
Sequence:CCGGCCAGCTGATTAACCCTCAGTACTCGAGTACTGAGGGTTAATCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011821.1-2244s1c1
Sequence:CCGGCCTCGTTTATTCCAGAGAGAACTCGAGTTCTCTCTGGAATAAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks