EMAIL THIS PAGE TO A FRIEND

GPCPD1

glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)

Synonyms: GDE5 GDPD6 PREI4
UniProtKB ID: Q9NPB8, D3DW06, Q9BQL8, Q9NUX0
Gene ID:
Mouse(74182) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Rat(362219) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Zebrafish(492483) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
cow(518469) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Horse(100051946) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
domestic cat(101081213) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
dog(485778) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
chicken(421311) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
domestic guinea pig(100713039) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
naked mole-rat(101716686) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
sheep(101115143) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Domestic Rabbit(100340388) glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
195 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153591 MISSION® esiRNA esiRNA human RP5-1022P6.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019593 Rosetta Predictions human pricing
NM_198779 Rosetta Predictions rat pricing
NM_001042671 Rosetta Predictions mouse pricing
NM_001042672 Rosetta Predictions mouse pricing
NM_027096 Rosetta Predictions mouse pricing
NM_028802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237716 predicted 1094
2 SASI_Hs01_00237717 predicted 1997
3 SASI_Hs01_00237718 predicted 1333
4 SASI_Hs01_00237719 predicted 2020
5 SASI_Hs01_00237720 predicted 379
6 SASI_Hs01_00237722 predicted 369
7 SASI_Hs01_00237723 predicted 1608
8 SASI_Hs01_00237724 predicted 1067
9 SASI_Hs01_00237725 predicted 879
10 SASI_Hs02_00352788 predicted 1414
11 SASI_Hs01_00237721 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087733 predicted 1254
2 SASI_Rn01_00087734 predicted 760
3 SASI_Rn01_00087735 predicted 326
4 SASI_Rn01_00087736 predicted 659
5 SASI_Rn01_00087737 predicted 1199
6 SASI_Rn02_00270041 predicted 1770
7 SASI_Rn01_00087738 predicted 1172
8 SASI_Rn01_00087739 predicted 1292
9 SASI_Rn01_00087740 predicted 375
10 SASI_Rn01_00087741 predicted 1331
11 SASI_Rn01_00087732 predicted 1903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290905 predicted 1407
2 SASI_Mm02_00290906 predicted 426
3 SASI_Mm02_00290907 predicted 770
4 SASI_Mm02_00290908 predicted 1428
5 SASI_Mm02_00290909 predicted 817
6 SASI_Mm02_00290910 predicted 1360
7 SASI_Mm02_00290911 predicted 477
8 SASI_Mm02_00290912 predicted 1106
9 SASI_Mm02_00290913 predicted 618
10 SASI_Mm02_00290914 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290915 predicted 1407
2 SASI_Mm02_00290916 predicted 428
3 SASI_Mm02_00290917 predicted 766
4 SASI_Mm02_00290918 predicted 1422
5 SASI_Mm02_00290919 predicted 814
6 SASI_Mm02_00290920 predicted 1354
7 SASI_Mm02_00290921 predicted 478
8 SASI_Mm02_00290922 predicted 1112
9 SASI_Mm02_00290923 predicted 624
10 SASI_Mm02_00290924 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168642 predicted 1148
2 SASI_Mm01_00168643 predicted 1033
3 SASI_Mm01_00168644 predicted 987
4 SASI_Mm01_00168645 predicted 1157
5 SASI_Mm01_00168646 predicted 1094
6 SASI_Mm01_00168647 predicted 828
7 SASI_Mm01_00168648 predicted 842
8 SASI_Mm01_00168649 predicted 1935
9 SASI_Mm01_00168650 predicted 1350
10 SASI_Mm01_00168651 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192518 predicted 1407
2 SASI_Mm02_00334409 predicted 427
3 SASI_Mm02_00334410 predicted 768
4 SASI_Mm01_00192521 predicted 1424
5 SASI_Mm02_00334411 predicted 813
6 SASI_Mm01_00192522 predicted 1359
7 SASI_Mm02_00334412 predicted 471
8 SASI_Mm01_00192524 predicted 1101
9 SASI_Mm02_00334413 predicted 619
10 SASI_Mm02_00334414 predicted 867
11 SASI_Mm01_00192519 predicted 521
12 SASI_Mm01_00192520 predicted 482
13 SASI_Mm01_00192523 predicted 318
14 SASI_Mm01_00192525 predicted 1425
15 SASI_Mm01_00192526 predicted 843
16 SASI_Mm01_00192527 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019593
VALIDATED
GPCPD1 MISSION shRNA Bacterial Glycerol Stock
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019593.2-2267s1c1
Sequence:CCGGCCGCTGTTCTGGGTATTCATTCTCGAGAATGAATACCCAGAACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019593.2-590s1c1
Sequence:CCGGGCTGACATGTCAGACTGAAATCTCGAGATTTCAGTCTGACATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_019593.2-1275s1c1
Sequence:CCGGGCCTTTGTAGAATTTGACGTACTCGAGTACGTCAAATTCTACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019593.2-1848s1c1
Sequence:CCGGGCAATGAGCTTTGCACAGTTTCTCGAGAAACTGTGCAAAGCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019593.2-3045s1c1
Sequence:CCGGGCTAGGTGAGTATGAGAAGATCTCGAGATCTTCTCATACTCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019593.2-2692s1c1
Sequence:CCGGCACAAATCTTTGTGCCATCTTCTCGAGAAGATGGCACAAAGATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019593.2-2114s1c1
Sequence:CCGGGCCAGAGCTTAAGAGCTGTTTCTCGAGAAACAGCTCTTAAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019593
VALIDATED
GPCPD1 MISSION shRNA shRNA Plasmid DNA
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019593.2-2267s1c1
Sequence:CCGGCCGCTGTTCTGGGTATTCATTCTCGAGAATGAATACCCAGAACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019593.2-590s1c1
Sequence:CCGGGCTGACATGTCAGACTGAAATCTCGAGATTTCAGTCTGACATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_019593.2-1275s1c1
Sequence:CCGGGCCTTTGTAGAATTTGACGTACTCGAGTACGTCAAATTCTACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019593.2-1848s1c1
Sequence:CCGGGCAATGAGCTTTGCACAGTTTCTCGAGAAACTGTGCAAAGCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019593.2-3045s1c1
Sequence:CCGGGCTAGGTGAGTATGAGAAGATCTCGAGATCTTCTCATACTCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019593.2-2692s1c1
Sequence:CCGGCACAAATCTTTGTGCCATCTTCTCGAGAAGATGGCACAAAGATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019593.2-2114s1c1
Sequence:CCGGGCCAGAGCTTAAGAGCTGTTTCTCGAGAAACAGCTCTTAAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019593
VALIDATED
GPCPD1 MISSION shRNA Lentiviral Transduction Particles
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019593.2-2267s1c1
Sequence:CCGGCCGCTGTTCTGGGTATTCATTCTCGAGAATGAATACCCAGAACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019593.2-590s1c1
Sequence:CCGGGCTGACATGTCAGACTGAAATCTCGAGATTTCAGTCTGACATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_019593.2-1275s1c1
Sequence:CCGGGCCTTTGTAGAATTTGACGTACTCGAGTACGTCAAATTCTACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019593.2-1848s1c1
Sequence:CCGGGCAATGAGCTTTGCACAGTTTCTCGAGAAACTGTGCAAAGCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019593.2-3045s1c1
Sequence:CCGGGCTAGGTGAGTATGAGAAGATCTCGAGATCTTCTCATACTCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019593.2-2692s1c1
Sequence:CCGGCACAAATCTTTGTGCCATCTTCTCGAGAAGATGGCACAAAGATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019593.2-2114s1c1
Sequence:CCGGGCCAGAGCTTAAGAGCTGTTTCTCGAGAAACAGCTCTTAAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027096
VALIDATED
GPCPD1 MISSION shRNA Bacterial Glycerol Stock
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027096.1-712s1c1
Sequence:CCGGCCTGTCTTCTACCATTGCTGACTCGAGTCAGCAATGGTAGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027096.1-1168s1c1
Sequence:CCGGGCTTTCTCATGTGACTGCATTCTCGAGAATGCAGTCACATGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027096.1-1483s1c1
Sequence:CCGGGAAGCAGAACAAATATCCCATCTCGAGATGGGATATTTGTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027096.1-2575s1c1
Sequence:CCGGGCAGGGTAACTTAATGTATAACTCGAGTTATACATTAAGTTACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027096.1-1633s1c1
Sequence:CCGGCCTCCTTAGAAACCCATCCTACTCGAGTAGGATGGGTTTCTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200255    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027096.1-1994s1c1
Sequence:CCGGCGCTGCCCTCATGTTTAGTTTCTCGAGAAACTAAACATGAGGGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027096.1-1733s1c1
Sequence:CCGGCTGAAGGAATTTGGAGTAAATCTCGAGATTTACTCCAAATTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027096
VALIDATED
GPCPD1 MISSION shRNA shRNA Plasmid DNA
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027096.1-712s1c1
Sequence:CCGGCCTGTCTTCTACCATTGCTGACTCGAGTCAGCAATGGTAGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027096.1-1168s1c1
Sequence:CCGGGCTTTCTCATGTGACTGCATTCTCGAGAATGCAGTCACATGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027096.1-1483s1c1
Sequence:CCGGGAAGCAGAACAAATATCCCATCTCGAGATGGGATATTTGTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027096.1-2575s1c1
Sequence:CCGGGCAGGGTAACTTAATGTATAACTCGAGTTATACATTAAGTTACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027096.1-1633s1c1
Sequence:CCGGCCTCCTTAGAAACCCATCCTACTCGAGTAGGATGGGTTTCTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200255    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027096.1-1994s1c1
Sequence:CCGGCGCTGCCCTCATGTTTAGTTTCTCGAGAAACTAAACATGAGGGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027096.1-1733s1c1
Sequence:CCGGCTGAAGGAATTTGGAGTAAATCTCGAGATTTACTCCAAATTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027096
VALIDATED
GPCPD1 MISSION shRNA Lentiviral Transduction Particles
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027096.1-712s1c1
Sequence:CCGGCCTGTCTTCTACCATTGCTGACTCGAGTCAGCAATGGTAGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027096.1-1168s1c1
Sequence:CCGGGCTTTCTCATGTGACTGCATTCTCGAGAATGCAGTCACATGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027096.1-1483s1c1
Sequence:CCGGGAAGCAGAACAAATATCCCATCTCGAGATGGGATATTTGTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027096.1-2575s1c1
Sequence:CCGGGCAGGGTAACTTAATGTATAACTCGAGTTATACATTAAGTTACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027096.1-1633s1c1
Sequence:CCGGCCTCCTTAGAAACCCATCCTACTCGAGTAGGATGGGTTTCTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200255    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027096.1-1994s1c1
Sequence:CCGGCGCTGCCCTCATGTTTAGTTTCTCGAGAAACTAAACATGAGGGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027096.1-1733s1c1
Sequence:CCGGCTGAAGGAATTTGGAGTAAATCTCGAGATTTACTCCAAATTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042671
GPCPD1 MISSION shRNA Bacterial Glycerol Stock
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-482s21c1
Sequence:CCGGCATCTACAACCACGATCAATACTCGAGTATTGATCGTGGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-2016s21c1
Sequence:CCGGTTGGAGTAAATGGTCTAATATCTCGAGATATTAGACCATTTACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042671.1-1622s1c1
Sequence:CCGGGATGGCAACTTATCAACATATCTCGAGATATGTTGATAAGTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042671.1-1943s1c1
Sequence:CCGGGCTAAGGGATTGGTCATATTCCTCGAGGAATATGACCAATCCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-1205s21c1
Sequence:CCGGACGACTGCCAAGCTAGCTAAACTCGAGTTTAGCTAGCTTGGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-1942s21c1
Sequence:CCGGAGCTAAGGGATTGGTCATATTCTCGAGAATATGACCAATCCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042671.1-2467s21c1
Sequence:CCGGTGAGATATCTAAGCCTATAATCTCGAGATTATAGGCTTAGATATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042671
GPCPD1 MISSION shRNA shRNA Plasmid DNA
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-482s21c1
Sequence:CCGGCATCTACAACCACGATCAATACTCGAGTATTGATCGTGGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-2016s21c1
Sequence:CCGGTTGGAGTAAATGGTCTAATATCTCGAGATATTAGACCATTTACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042671.1-1622s1c1
Sequence:CCGGGATGGCAACTTATCAACATATCTCGAGATATGTTGATAAGTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042671.1-1943s1c1
Sequence:CCGGGCTAAGGGATTGGTCATATTCCTCGAGGAATATGACCAATCCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-1205s21c1
Sequence:CCGGACGACTGCCAAGCTAGCTAAACTCGAGTTTAGCTAGCTTGGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-1942s21c1
Sequence:CCGGAGCTAAGGGATTGGTCATATTCTCGAGAATATGACCAATCCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042671.1-2467s21c1
Sequence:CCGGTGAGATATCTAAGCCTATAATCTCGAGATTATAGGCTTAGATATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042671
GPCPD1 MISSION shRNA Lentiviral Transduction Particles
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-482s21c1
Sequence:CCGGCATCTACAACCACGATCAATACTCGAGTATTGATCGTGGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-2016s21c1
Sequence:CCGGTTGGAGTAAATGGTCTAATATCTCGAGATATTAGACCATTTACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042671.1-1622s1c1
Sequence:CCGGGATGGCAACTTATCAACATATCTCGAGATATGTTGATAAGTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042671.1-1943s1c1
Sequence:CCGGGCTAAGGGATTGGTCATATTCCTCGAGGAATATGACCAATCCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-1205s21c1
Sequence:CCGGACGACTGCCAAGCTAGCTAAACTCGAGTTTAGCTAGCTTGGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042671.1-1942s21c1
Sequence:CCGGAGCTAAGGGATTGGTCATATTCTCGAGAATATGACCAATCCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042671.1-2467s21c1
Sequence:CCGGTGAGATATCTAAGCCTATAATCTCGAGATTATAGGCTTAGATATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks