EMAIL THIS PAGE TO A FRIEND

GPD1

glycerol-3-phosphate dehydrogenase 1 (soluble)

97 Gene Product Result for
Synonyms: GPD-C GPDH-C HTGTI
UniProtKB ID: P21695, F8W1L5, Q8N1B0
Gene ID:
Human(2819) Summary: This gene encodes a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. The encoded protein plays a critical role in carbohydrate and lipid metabolism by catalyzing the reversible conversion of dihydroxyacetone phosphate (DHAP) and reduced nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. The encoded cytosolic protein and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in this gene are a cause of transient infantile hypertriglyceridemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
Mouse(14555) glycerol-3-phosphate dehydrogenase 1 (soluble)
Rat(60666) glycerol-3-phosphate dehydrogenase 1 (soluble)
chicken(424263) glycerol-3-phosphate dehydrogenase 1 (soluble)
domestic cat(101086577) glycerol-3-phosphate dehydrogenase 1 (soluble)
cow(525042) glycerol-3-phosphate dehydrogenase 1 (soluble)
Horse(100052204) glycerol-3-phosphate dehydrogenase 1 (soluble)
dog(607942) glycerol-3-phosphate dehydrogenase 1 (soluble)
sheep(101119894) glycerol-3-phosphate dehydrogenase 1 (soluble)
domestic guinea pig(100720368) glycerol-3-phosphate dehydrogenase 1 (soluble)
naked mole-rat(101702723) glycerol-3-phosphate dehydrogenase 1 (soluble)
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100953 Anti-GPD1 antibody produced in rabbit affinity isolated antibody rabbit, bovine, zebrafish, pig, horse, human, mouse, rat, guinea pig, rabbit
western blot pricing
SAB2103337 Anti-GPD1 antibody produced in rabbit affinity isolated antibody rat, guinea pig, rabbit, horse, pig, mouse, rabbit, bovine, human
western blot pricing
HPA044620 Anti-GPD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
WH0002819M1 Monoclonal Anti-GPD1 antibody produced in mouse clone 3C10-1C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK208 GPDH Activity Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005276 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150771 MISSION® esiRNA esiRNA human GPD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005276 Rosetta Predictions human pricing
NM_022215 Rosetta Predictions rat pricing
NM_010271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225915 predicted 615
2 SASI_Hs01_00225916 predicted 313
3 SASI_Hs01_00225917 predicted 283
4 SASI_Hs01_00225918 predicted 986
5 SASI_Hs01_00225919 predicted 1280
6 SASI_Hs01_00225921 predicted 707
7 SASI_Hs01_00225922 predicted 500
8 SASI_Hs01_00225923 predicted 730
9 SASI_Hs01_00225924 predicted 345
10 SASI_Hs02_00339328 predicted 1467
11 SASI_Hs01_00225920 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046488 predicted 1385
2 SASI_Rn01_00046489 predicted 572
3 SASI_Rn01_00046491 predicted 288
4 SASI_Rn02_00262971 predicted 320
5 SASI_Rn01_00046492 predicted 467
6 SASI_Rn01_00046494 predicted 924
7 SASI_Rn02_00262972 predicted 1517
8 SASI_Rn02_00262973 predicted 1451
9 SASI_Rn01_00046495 predicted 884
10 SASI_Rn01_00046497 predicted 329
11 SASI_Rn01_00046490 predicted 314
12 SASI_Rn01_00046493 predicted 1516
13 SASI_Rn01_00046496 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104249 predicted 567
2 SASI_Mm02_00318186 predicted 1510
3 SASI_Mm01_00104250 predicted 577
4 SASI_Mm01_00104252 predicted 300
5 SASI_Mm01_00104253 predicted 333
6 SASI_Mm01_00104254 predicted 404
7 SASI_Mm01_00104255 predicted 885
8 SASI_Mm01_00104256 predicted 711
9 SASI_Mm02_00318187 predicted 1227
10 SASI_Mm01_00104258 predicted 486
11 SASI_Mm01_00104251 predicted 844
12 SASI_Mm01_00104257 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010271
VALIDATED
GPD1 MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate dehydrogenase 1 (soluble)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010271.2-392s21c1
Sequence:CCGGCCAACGGGCTGAAGCTCATTTCTCGAGAAATGAGCTTCAGCCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010271.2-1048s21c1
Sequence:CCGGCACCCGGAACACATGTGAATGCTCGAGCATTCACATGTGTTCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-2480s1c1
Sequence:CCGGGCCAGCTTGATATTAAACTAACTCGAGTTAGTTTAATATCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-985s1c1
Sequence:CCGGGCGGTGTACAAAGTGTGCTATCTCGAGATAGCACACTTTGTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010271.2-336s1c1
Sequence:CCGGCCACTTGAAGGCCAATACTATCTCGAGATAGTATTGGCCTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-297s1c1
Sequence:CCGGCCATCAGTTCATTGGCAAGATCTCGAGATCTTGCCAATGAACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-933s1c1
Sequence:CCGGGCACAGCATTCTCCAACACAACTCGAGTTGTGTTGGAGAATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010271
VALIDATED
GPD1 MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate dehydrogenase 1 (soluble)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010271.2-392s21c1
Sequence:CCGGCCAACGGGCTGAAGCTCATTTCTCGAGAAATGAGCTTCAGCCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010271.2-1048s21c1
Sequence:CCGGCACCCGGAACACATGTGAATGCTCGAGCATTCACATGTGTTCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-2480s1c1
Sequence:CCGGGCCAGCTTGATATTAAACTAACTCGAGTTAGTTTAATATCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-985s1c1
Sequence:CCGGGCGGTGTACAAAGTGTGCTATCTCGAGATAGCACACTTTGTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010271.2-336s1c1
Sequence:CCGGCCACTTGAAGGCCAATACTATCTCGAGATAGTATTGGCCTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-297s1c1
Sequence:CCGGCCATCAGTTCATTGGCAAGATCTCGAGATCTTGCCAATGAACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-933s1c1
Sequence:CCGGGCACAGCATTCTCCAACACAACTCGAGTTGTGTTGGAGAATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010271
VALIDATED
GPD1 MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate dehydrogenase 1 (soluble)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010271.2-392s21c1
Sequence:CCGGCCAACGGGCTGAAGCTCATTTCTCGAGAAATGAGCTTCAGCCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010271.2-1048s21c1
Sequence:CCGGCACCCGGAACACATGTGAATGCTCGAGCATTCACATGTGTTCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-2480s1c1
Sequence:CCGGGCCAGCTTGATATTAAACTAACTCGAGTTAGTTTAATATCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-985s1c1
Sequence:CCGGGCGGTGTACAAAGTGTGCTATCTCGAGATAGCACACTTTGTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010271.2-336s1c1
Sequence:CCGGCCACTTGAAGGCCAATACTATCTCGAGATAGTATTGGCCTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-297s1c1
Sequence:CCGGCCATCAGTTCATTGGCAAGATCTCGAGATCTTGCCAATGAACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010271.2-933s1c1
Sequence:CCGGGCACAGCATTCTCCAACACAACTCGAGTTGTGTTGGAGAATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005276
GPD1 MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate dehydrogenase 1 (soluble)
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005276.2-1920s1c1
Sequence:CCGGCCTTTCATAACAGGCTCAGATCTCGAGATCTGAGCCTGTTATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-639s1c1
Sequence:CCGGCTTAAAGAATGTAGTGGCCGTCTCGAGACGGCCACTACATTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-200s1c1
Sequence:CCGGCGCAGCATGAGAATGTCAAATCTCGAGATTTGACATTCTCATGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-1056s1c1
Sequence:CCGGCCTGCAGAATCATCCAGAACACTCGAGTGTTCTGGATGATTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-975s1c1
Sequence:CCGGCCTGGTAGACAAGTTTCCCTTCTCGAGAAGGGAAACTTGTCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-867s1c1
Sequence:CCGGGCGTACAGGAAAGTCCATTGACTCGAGTCAATGGACTTTCCTGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-187s1c1
Sequence:CCGGGAGATCATCAACACGCAGCATCTCGAGATGCTGCGTGTTGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-891s1c1
Sequence:CCGGGCTGGAGAAAGAGTTGCTGAACTCGAGTTCAGCAACTCTTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005276.2-1449s1c1
Sequence:CCGGGCTGTCTCACATACACCAGTACTCGAGTACTGGTGTATGTGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-420s1c1
Sequence:CCGGGAAGCTCATCTCGGAAGTGATCTCGAGATCACTTCCGAGATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-811s1c1
Sequence:CCGGGACCTGATCACTACCTGCTATCTCGAGATAGCAGGTAGTGATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-570s1c1
Sequence:CCGGGCTGATGCAGACACCAAACTTCTCGAGAAGTTTGGTGTCTGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-201s1c1
Sequence:CCGGGCAGCATGAGAATGTCAAATACTCGAGTATTTGACATTCTCATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-576s1c1
Sequence:CCGGGCAGACACCAAACTTCCGTATCTCGAGATACGGAAGTTTGGTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-370s1c1
Sequence:CCGGGCCACTGGCATATCTCTTATTCTCGAGAATAAGAGATATGCCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005276.2-1278s1c1
Sequence:CCGGGCCACCACATTTGCCAGAAATCTCGAGATTTCTGGCAAATGTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-315s1c1
Sequence:CCGGCCATCAGTTCATCGGCAAGATCTCGAGATCTTGCCGATGAACTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005276
GPD1 MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate dehydrogenase 1 (soluble)
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005276.2-1920s1c1
Sequence:CCGGCCTTTCATAACAGGCTCAGATCTCGAGATCTGAGCCTGTTATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-639s1c1
Sequence:CCGGCTTAAAGAATGTAGTGGCCGTCTCGAGACGGCCACTACATTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-200s1c1
Sequence:CCGGCGCAGCATGAGAATGTCAAATCTCGAGATTTGACATTCTCATGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-1056s1c1
Sequence:CCGGCCTGCAGAATCATCCAGAACACTCGAGTGTTCTGGATGATTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-975s1c1
Sequence:CCGGCCTGGTAGACAAGTTTCCCTTCTCGAGAAGGGAAACTTGTCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-867s1c1
Sequence:CCGGGCGTACAGGAAAGTCCATTGACTCGAGTCAATGGACTTTCCTGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-187s1c1
Sequence:CCGGGAGATCATCAACACGCAGCATCTCGAGATGCTGCGTGTTGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-891s1c1
Sequence:CCGGGCTGGAGAAAGAGTTGCTGAACTCGAGTTCAGCAACTCTTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005276.2-1449s1c1
Sequence:CCGGGCTGTCTCACATACACCAGTACTCGAGTACTGGTGTATGTGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-420s1c1
Sequence:CCGGGAAGCTCATCTCGGAAGTGATCTCGAGATCACTTCCGAGATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-811s1c1
Sequence:CCGGGACCTGATCACTACCTGCTATCTCGAGATAGCAGGTAGTGATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-570s1c1
Sequence:CCGGGCTGATGCAGACACCAAACTTCTCGAGAAGTTTGGTGTCTGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-201s1c1
Sequence:CCGGGCAGCATGAGAATGTCAAATACTCGAGTATTTGACATTCTCATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-576s1c1
Sequence:CCGGGCAGACACCAAACTTCCGTATCTCGAGATACGGAAGTTTGGTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-370s1c1
Sequence:CCGGGCCACTGGCATATCTCTTATTCTCGAGAATAAGAGATATGCCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005276.2-1278s1c1
Sequence:CCGGGCCACCACATTTGCCAGAAATCTCGAGATTTCTGGCAAATGTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-315s1c1
Sequence:CCGGCCATCAGTTCATCGGCAAGATCTCGAGATCTTGCCGATGAACTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005276
GPD1 MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate dehydrogenase 1 (soluble)
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005276.2-1920s1c1
Sequence:CCGGCCTTTCATAACAGGCTCAGATCTCGAGATCTGAGCCTGTTATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-639s1c1
Sequence:CCGGCTTAAAGAATGTAGTGGCCGTCTCGAGACGGCCACTACATTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-200s1c1
Sequence:CCGGCGCAGCATGAGAATGTCAAATCTCGAGATTTGACATTCTCATGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-1056s1c1
Sequence:CCGGCCTGCAGAATCATCCAGAACACTCGAGTGTTCTGGATGATTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-975s1c1
Sequence:CCGGCCTGGTAGACAAGTTTCCCTTCTCGAGAAGGGAAACTTGTCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-867s1c1
Sequence:CCGGGCGTACAGGAAAGTCCATTGACTCGAGTCAATGGACTTTCCTGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-187s1c1
Sequence:CCGGGAGATCATCAACACGCAGCATCTCGAGATGCTGCGTGTTGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-891s1c1
Sequence:CCGGGCTGGAGAAAGAGTTGCTGAACTCGAGTTCAGCAACTCTTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005276.2-1449s1c1
Sequence:CCGGGCTGTCTCACATACACCAGTACTCGAGTACTGGTGTATGTGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-420s1c1
Sequence:CCGGGAAGCTCATCTCGGAAGTGATCTCGAGATCACTTCCGAGATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005276.2-811s1c1
Sequence:CCGGGACCTGATCACTACCTGCTATCTCGAGATAGCAGGTAGTGATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-570s1c1
Sequence:CCGGGCTGATGCAGACACCAAACTTCTCGAGAAGTTTGGTGTCTGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-201s1c1
Sequence:CCGGGCAGCATGAGAATGTCAAATACTCGAGTATTTGACATTCTCATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-576s1c1
Sequence:CCGGGCAGACACCAAACTTCCGTATCTCGAGATACGGAAGTTTGGTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-370s1c1
Sequence:CCGGGCCACTGGCATATCTCTTATTCTCGAGAATAAGAGATATGCCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005276.2-1278s1c1
Sequence:CCGGGCCACCACATTTGCCAGAAATCTCGAGATTTCTGGCAAATGTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005276.2-315s1c1
Sequence:CCGGCCATCAGTTCATCGGCAAGATCTCGAGATCTTGCCGATGAACTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks