EMAIL THIS PAGE TO A FRIEND

GPD1L

glycerol-3-phosphate dehydrogenase 1-like

116 Gene Product Result for
Synonyms: GPD1-L
UniProtKB ID: Q8N335, A8K9U3, Q14702, Q9BRM5
Gene ID:
Human(23171) Summary: The protein encoded by this gene catalyzes the conversion of sn-glycerol 3-phosphate to glycerone phosphate. The encoded protein is found in the cytoplasm, associated with the plasma membrane, where it binds the sodium channel, voltage-gated, type V, alpha subunit (SCN5A). Defects in this gene are a cause of Brugada syndrome type 2 (BRS2) as well as sudden infant death syndrome (SIDS). [provided by RefSeq, Jul 2010]
Mouse(333433) glycerol-3-phosphate dehydrogenase 1-like
Rat(363159) glycerol-3-phosphate dehydrogenase 1-like
Zebrafish(449663) glycerol-3-phosphate dehydrogenase 1-like
domestic cat(101093135) glycerol-3-phosphate dehydrogenase 1-like
cow(514456) glycerol-3-phosphate dehydrogenase 1-like
dog(485626) glycerol-3-phosphate dehydrogenase 1-like
chicken(420664) glycerol-3-phosphate dehydrogenase 1-like
domestic guinea pig(100735157) glycerol-3-phosphate dehydrogenase 1-like
naked mole-rat(101707148) glycerol-3-phosphate dehydrogenase 1-like
sheep(101104692) glycerol-3-phosphate dehydrogenase 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015141 Rosetta Predictions human pricing
XM_001077897 Rosetta Predictions rat pricing
XM_343498 Rosetta Predictions rat pricing
NM_175380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222453 predicted 467
2 SASI_Hs02_00347074 predicted 1104
3 SASI_Hs01_00222454 predicted 1189
4 SASI_Hs01_00222455 predicted 1131
5 SASI_Hs01_00222456 predicted 959
6 SASI_Hs01_00222457 predicted 620
7 SASI_Hs01_00222458 predicted 648
8 SASI_Hs01_00222459 predicted 480
9 SASI_Hs01_00222460 predicted 1210
10 SASI_Hs01_00222461 predicted 1030
11 SASI_Hs01_00222462 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358918 predicted 564
2 SASI_Rn02_00358919 predicted 547
3 SASI_Rn02_00358920 predicted 357
4 SASI_Rn02_00358921 predicted 233
5 SASI_Rn02_00358922 predicted 778
6 SASI_Rn02_00358923 predicted 573
7 SASI_Rn02_00358924 predicted 476
8 SASI_Rn02_00358925 predicted 814
9 SASI_Rn02_00358926 predicted 617
10 SASI_Rn02_00358927 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395894 predicted 811
2 SASI_Rn02_00395895 predicted 767
3 SASI_Rn02_00395896 predicted 816
4 SASI_Rn02_00395897 predicted 778
5 SASI_Rn02_00395898 predicted 816
6 SASI_Rn02_00395899 predicted 926
7 SASI_Rn02_00395900 predicted 713
8 SASI_Rn02_00395901 predicted 725
9 SASI_Rn02_00395902 predicted 795
10 SASI_Rn02_00395903 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161202 predicted 497
2 SASI_Mm01_00161203 predicted 626
3 SASI_Mm01_00161204 predicted 652
4 SASI_Mm01_00161206 predicted 406
5 SASI_Mm01_00161207 predicted 504
6 SASI_Mm01_00161208 predicted 321
7 SASI_Mm01_00161209 predicted 627
8 SASI_Mm01_00161210 predicted 786
9 SASI_Mm01_00161211 predicted 320
10 SASI_Mm02_00346210 predicted 806
11 SASI_Mm01_00161205 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015141
VALIDATED
GPD1L MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate dehydrogenase 1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-564s1c1
Sequence:CCGGCGGCAGCAAAGTAATGGAGAACTCGAGTTCTCCATTACTTTGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-966s1c1
Sequence:CCGGGCAGACTTCTGCTGAAGTGTACTCGAGTACACTTCAGCAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-405s1c1
Sequence:CCGGGCTGGGAATCACCCTCATCAACTCGAGTTGATGAGGGTGATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-347s1c1
Sequence:CCGGCCCACCAGTTCATTCACAGAACTCGAGTTCTGTGAATGAACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-1012s1c1
Sequence:CCGGCTGGACAAGTTTCCATTGTTTCTCGAGAAACAATGGAAACTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-564s21c1
Sequence:CCGGCGGCAGCAAAGTAATGGAGAACTCGAGTTCTCCATTACTTTGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-966s21c1
Sequence:CCGGGCAGACTTCTGCTGAAGTGTACTCGAGTACACTTCAGCAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-405s21c1
Sequence:CCGGGCTGGGAATCACCCTCATCAACTCGAGTTGATGAGGGTGATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-1407s21c1
Sequence:CCGGCCACACAATCGTAGCTTATAACTCGAGTTATAAGCTACGATTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-473s21c1
Sequence:CCGGTCCGTGAGAAGATGGGTATTGCTCGAGCAATACCCATCTTCTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015141
VALIDATED
GPD1L MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate dehydrogenase 1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-564s1c1
Sequence:CCGGCGGCAGCAAAGTAATGGAGAACTCGAGTTCTCCATTACTTTGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-966s1c1
Sequence:CCGGGCAGACTTCTGCTGAAGTGTACTCGAGTACACTTCAGCAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-405s1c1
Sequence:CCGGGCTGGGAATCACCCTCATCAACTCGAGTTGATGAGGGTGATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-347s1c1
Sequence:CCGGCCCACCAGTTCATTCACAGAACTCGAGTTCTGTGAATGAACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-1012s1c1
Sequence:CCGGCTGGACAAGTTTCCATTGTTTCTCGAGAAACAATGGAAACTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-564s21c1
Sequence:CCGGCGGCAGCAAAGTAATGGAGAACTCGAGTTCTCCATTACTTTGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-966s21c1
Sequence:CCGGGCAGACTTCTGCTGAAGTGTACTCGAGTACACTTCAGCAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-405s21c1
Sequence:CCGGGCTGGGAATCACCCTCATCAACTCGAGTTGATGAGGGTGATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-1407s21c1
Sequence:CCGGCCACACAATCGTAGCTTATAACTCGAGTTATAAGCTACGATTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-473s21c1
Sequence:CCGGTCCGTGAGAAGATGGGTATTGCTCGAGCAATACCCATCTTCTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015141
VALIDATED
GPD1L MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate dehydrogenase 1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-564s1c1
Sequence:CCGGCGGCAGCAAAGTAATGGAGAACTCGAGTTCTCCATTACTTTGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-966s1c1
Sequence:CCGGGCAGACTTCTGCTGAAGTGTACTCGAGTACACTTCAGCAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-405s1c1
Sequence:CCGGGCTGGGAATCACCCTCATCAACTCGAGTTGATGAGGGTGATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-347s1c1
Sequence:CCGGCCCACCAGTTCATTCACAGAACTCGAGTTCTGTGAATGAACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015141.2-1012s1c1
Sequence:CCGGCTGGACAAGTTTCCATTGTTTCTCGAGAAACAATGGAAACTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-564s21c1
Sequence:CCGGCGGCAGCAAAGTAATGGAGAACTCGAGTTCTCCATTACTTTGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-966s21c1
Sequence:CCGGGCAGACTTCTGCTGAAGTGTACTCGAGTACACTTCAGCAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-405s21c1
Sequence:CCGGGCTGGGAATCACCCTCATCAACTCGAGTTGATGAGGGTGATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-1407s21c1
Sequence:CCGGCCACACAATCGTAGCTTATAACTCGAGTTATAAGCTACGATTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015141.2-473s21c1
Sequence:CCGGTCCGTGAGAAGATGGGTATTGCTCGAGCAATACCCATCTTCTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175380
VALIDATED
GPD1L MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate dehydrogenase 1-like
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-1086s1c1
Sequence:CCGGCTGCAGTGTATCAGATCTGCTCTCGAGAGCAGATCTGATACACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-208s1c1
Sequence:CCGGGAAATTCTCCTCCACCGTCAACTCGAGTTGACGGTGGAGGAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-412s1c1
Sequence:CCGGCCACAAGATCTGCGATGAGATCTCGAGATCTCATCGCAGATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-827s1c1
Sequence:CCGGGCTTTCGCCAAGATCTTCTGTCTCGAGACAGAAGATCTTGGCGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-265s1c1
Sequence:CCGGGCTGACAGACATAATCAACAACTCGAGTTGTTGATTATGTCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-1088s1c1
Sequence:CCGGGCAGTGTATCAGATCTGCTATCTCGAGATAGCAGATCTGATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175380.3-835s1c1
Sequence:CCGGCAAGATCTTCTGTAAGGGCCACTCGAGTGGCCCTTACAGAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-517s1c1
Sequence:CCGGCGACATCATCCGAGAGAAGATCTCGAGATCTTCTCTCGGATGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-298s1c1
Sequence:CCGGCGTGAAATATCTCCCAGGACACTCGAGTGTCCTGGGAGATATTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-505s1c1
Sequence:CCGGGAAGCTAATCTCCGACATCATCTCGAGATGATGTCGGAGATTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-667s1c1
Sequence:CCGGGCCCAACTTCAGAATCACTGTCTCGAGACAGTGATTCTGAAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175380
VALIDATED
GPD1L MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate dehydrogenase 1-like
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-1086s1c1
Sequence:CCGGCTGCAGTGTATCAGATCTGCTCTCGAGAGCAGATCTGATACACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-208s1c1
Sequence:CCGGGAAATTCTCCTCCACCGTCAACTCGAGTTGACGGTGGAGGAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-412s1c1
Sequence:CCGGCCACAAGATCTGCGATGAGATCTCGAGATCTCATCGCAGATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-827s1c1
Sequence:CCGGGCTTTCGCCAAGATCTTCTGTCTCGAGACAGAAGATCTTGGCGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-265s1c1
Sequence:CCGGGCTGACAGACATAATCAACAACTCGAGTTGTTGATTATGTCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-1088s1c1
Sequence:CCGGGCAGTGTATCAGATCTGCTATCTCGAGATAGCAGATCTGATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175380.3-835s1c1
Sequence:CCGGCAAGATCTTCTGTAAGGGCCACTCGAGTGGCCCTTACAGAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-517s1c1
Sequence:CCGGCGACATCATCCGAGAGAAGATCTCGAGATCTTCTCTCGGATGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-298s1c1
Sequence:CCGGCGTGAAATATCTCCCAGGACACTCGAGTGTCCTGGGAGATATTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-505s1c1
Sequence:CCGGGAAGCTAATCTCCGACATCATCTCGAGATGATGTCGGAGATTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-667s1c1
Sequence:CCGGGCCCAACTTCAGAATCACTGTCTCGAGACAGTGATTCTGAAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175380
VALIDATED
GPD1L MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate dehydrogenase 1-like
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-1086s1c1
Sequence:CCGGCTGCAGTGTATCAGATCTGCTCTCGAGAGCAGATCTGATACACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-208s1c1
Sequence:CCGGGAAATTCTCCTCCACCGTCAACTCGAGTTGACGGTGGAGGAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-412s1c1
Sequence:CCGGCCACAAGATCTGCGATGAGATCTCGAGATCTCATCGCAGATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175380.3-827s1c1
Sequence:CCGGGCTTTCGCCAAGATCTTCTGTCTCGAGACAGAAGATCTTGGCGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-265s1c1
Sequence:CCGGGCTGACAGACATAATCAACAACTCGAGTTGTTGATTATGTCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-1088s1c1
Sequence:CCGGGCAGTGTATCAGATCTGCTATCTCGAGATAGCAGATCTGATACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175380.3-835s1c1
Sequence:CCGGCAAGATCTTCTGTAAGGGCCACTCGAGTGGCCCTTACAGAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-517s1c1
Sequence:CCGGCGACATCATCCGAGAGAAGATCTCGAGATCTTCTCTCGGATGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-298s1c1
Sequence:CCGGCGTGAAATATCTCCCAGGACACTCGAGTGTCCTGGGAGATATTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-505s1c1
Sequence:CCGGGAAGCTAATCTCCGACATCATCTCGAGATGATGTCGGAGATTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175380.3-667s1c1
Sequence:CCGGGCCCAACTTCAGAATCACTGTCTCGAGACAGTGATTCTGAAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks