EMAIL THIS PAGE TO A FRIEND

GPD2

glycerol-3-phosphate dehydrogenase 2 (mitochondrial)

176 Gene Product Result for
Synonyms: GDH2 GPDM mGPDH
UniProtKB ID: P43304, A8K4V0, B3KSA9, Q59FR1, Q9HAP9
Gene ID:
Human(2820) Summary: The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
Mouse(14571) glycerol phosphate dehydrogenase 2, mitochondrial
Rat(25062) glycerol-3-phosphate dehydrogenase 2, mitochondrial
domestic guinea pig(100721200) glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
naked mole-rat(101715967) glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
Zebrafish(751628) glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
cow(504948) glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
Horse(100050747) glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
chicken(424321) glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
domestic cat(101089953) glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
dog(478755) glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK208 GPDH Activity Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000408 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065331 MISSION® esiRNA esiRNA human GPD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000408 Rosetta Predictions human pricing
NM_001083112 Rosetta Predictions human pricing
NM_012736 Rosetta Predictions rat pricing
NM_010274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150289 predicted 655
2 SASI_Hs02_00302497 predicted 767
3 SASI_Hs02_00302498 predicted 472
4 SASI_Hs01_00150291 predicted 1996
5 SASI_Hs02_00302499 predicted 600
6 SASI_Hs02_00302500 predicted 1688
7 SASI_Hs01_00150292 predicted 860
8 SASI_Hs01_00150294 predicted 1261
9 SASI_Hs02_00302501 predicted 2265
10 SASI_Hs01_00150296 predicted 2258
11 SASI_Hs01_00150288 predicted 603
12 SASI_Hs01_00150290 predicted 329
13 SASI_Hs01_00150293 predicted 1186
14 SASI_Hs01_00150295 predicted 1074
15 SASI_Hs01_00150297 predicted 1869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316854 predicted 880
2 SASI_Hs02_00316855 predicted 1000
3 SASI_Hs02_00316856 predicted 695
4 SASI_Hs02_00316857 predicted 2226
5 SASI_Hs02_00316858 predicted 825
6 SASI_Hs02_00316859 predicted 1909
7 SASI_Hs02_00316860 predicted 1090
8 SASI_Hs02_00316861 predicted 1492
9 SASI_Hs02_00316862 predicted 2497
10 SASI_Hs02_00316863 predicted 2479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260086 predicted 1395
2 SASI_Rn01_00115093 predicted 1793
3 SASI_Rn01_00115094 predicted 656
4 SASI_Rn01_00115095 predicted 1086
5 SASI_Rn01_00115096 predicted 1827
6 SASI_Rn01_00115097 predicted 1964
7 SASI_Rn01_00115098 predicted 1229
8 SASI_Rn01_00115099 predicted 291
9 SASI_Rn01_00115100 predicted 564
10 SASI_Rn01_00115101 predicted 1194
11 SASI_Rn01_00115102 predicted 1906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093952 predicted 2021
2 SASI_Mm01_00093953 predicted 1998
3 SASI_Mm01_00093954 predicted 929
4 SASI_Mm01_00093956 predicted 1629
5 SASI_Mm01_00093957 predicted 1242
6 SASI_Mm01_00093958 predicted 856
7 SASI_Mm01_00093959 predicted 1290
8 SASI_Mm02_00318199 predicted 1670
9 SASI_Mm01_00093960 predicted 1904
10 SASI_Mm02_00318200 predicted 664
11 SASI_Mm01_00093955 predicted 1426
12 SASI_Mm01_00093961 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010274
VALIDATED
GPD2 MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010274.3-1034s21c1
Sequence:CCGGCGTGAGAGCCAAATGCGTTATCTCGAGATAACGCATTTGGCTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010274.3-1799s21c1
Sequence:CCGGAGAGGTGAAATACGGGATTAACTCGAGTTAATCCCGTATTTCACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010274.3-668s21c1
Sequence:CCGGGCCTATCATGCTTCCACTTTACTCGAGTAAAGTGGAAGCATGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010274.2-2476s1c1
Sequence:CCGGTGACCAGTAAATCCGCCACCACTCGAGTGGTGGCGGATTTACTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-1891s1c1
Sequence:CCGGGCAGAGGTGAAATACGGCATTCTCGAGAATGCCGTATTTCACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-2236s1c1
Sequence:CCGGCGTGTCCTAGAGAGTATCAATCTCGAGATTGATACTCTCTAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-1261s1c1
Sequence:CCGGCCTGAGAACATGGGACTTCTTCTCGAGAAGAAGTCCCATGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-2071s1c1
Sequence:CCGGGCCACGAGATTTCTGTACTATCTCGAGATAGTACAGAAATCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010274
VALIDATED
GPD2 MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010274.3-1034s21c1
Sequence:CCGGCGTGAGAGCCAAATGCGTTATCTCGAGATAACGCATTTGGCTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010274.3-1799s21c1
Sequence:CCGGAGAGGTGAAATACGGGATTAACTCGAGTTAATCCCGTATTTCACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010274.3-668s21c1
Sequence:CCGGGCCTATCATGCTTCCACTTTACTCGAGTAAAGTGGAAGCATGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010274.2-2476s1c1
Sequence:CCGGTGACCAGTAAATCCGCCACCACTCGAGTGGTGGCGGATTTACTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-1891s1c1
Sequence:CCGGGCAGAGGTGAAATACGGCATTCTCGAGAATGCCGTATTTCACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-2236s1c1
Sequence:CCGGCGTGTCCTAGAGAGTATCAATCTCGAGATTGATACTCTCTAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-1261s1c1
Sequence:CCGGCCTGAGAACATGGGACTTCTTCTCGAGAAGAAGTCCCATGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-2071s1c1
Sequence:CCGGGCCACGAGATTTCTGTACTATCTCGAGATAGTACAGAAATCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010274
VALIDATED
GPD2 MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010274.3-1034s21c1
Sequence:CCGGCGTGAGAGCCAAATGCGTTATCTCGAGATAACGCATTTGGCTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010274.3-1799s21c1
Sequence:CCGGAGAGGTGAAATACGGGATTAACTCGAGTTAATCCCGTATTTCACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010274.3-668s21c1
Sequence:CCGGGCCTATCATGCTTCCACTTTACTCGAGTAAAGTGGAAGCATGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010274.2-2476s1c1
Sequence:CCGGTGACCAGTAAATCCGCCACCACTCGAGTGGTGGCGGATTTACTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-1891s1c1
Sequence:CCGGGCAGAGGTGAAATACGGCATTCTCGAGAATGCCGTATTTCACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-2236s1c1
Sequence:CCGGCGTGTCCTAGAGAGTATCAATCTCGAGATTGATACTCTCTAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-1261s1c1
Sequence:CCGGCCTGAGAACATGGGACTTCTTCTCGAGAAGAAGTCCCATGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010274.2-2071s1c1
Sequence:CCGGGCCACGAGATTTCTGTACTATCTCGAGATAGTACAGAAATCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000408
VALIDATED
GPD2 MISSION shRNA Bacterial Glycerol Stock
glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-1461s21c1
Sequence:CCGGATGGCAGAAGATACCATAAATCTCGAGATTTATGGTATCTTCTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-785s21c1
Sequence:CCGCCTACTATGACGGACAACATAACTCGAGTTATGTTGTCCGTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-563s21c1
Sequence:CCGGGCGTGCCAACCTGCTAGAAATCTCGAGATTTCTAGCAGGTTGGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-1874s21c1
Sequence:CCGGACTGAATTGGGATGATTATAACTCGAGTTATAATCATCCCAATTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000408.4-2701s21c1
Sequence:CCGGCAGATAGCATGTGTTATTAAACTCGAGTTTAATAACACATGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-2043s21c1
Sequence:CCGGGCAGACCAGAAAGGCTTTATTCTCGAGAATAAAGCCTTTCTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-2071s1c1
Sequence:CCGGCGTGTATTAGAGAGTATCAATCTCGAGATTGATACTCTCTAATACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-496s1c1
Sequence:CCGGGCCATCATGAAGTTGGATATTCTCGAGAATATCCAACTTCATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000408.1-1986s1c1
Sequence:CCGGGCCTTCAGACATTGACAGGTACTCGAGTACCTGTCAATGTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-1552s1c1
Sequence:CCGGCCCACACTCTACATTAGGCTTCTCGAGAAGCCTAATGTAGAGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-695s1c1
Sequence:CCGGGCAGTTATGTCCTCAGCAAATCTCGAGATTTGCTGAGGACATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000408
VALIDATED
GPD2 MISSION shRNA shRNA Plasmid DNA
glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-1461s21c1
Sequence:CCGGATGGCAGAAGATACCATAAATCTCGAGATTTATGGTATCTTCTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-785s21c1
Sequence:CCGCCTACTATGACGGACAACATAACTCGAGTTATGTTGTCCGTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-563s21c1
Sequence:CCGGGCGTGCCAACCTGCTAGAAATCTCGAGATTTCTAGCAGGTTGGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-1874s21c1
Sequence:CCGGACTGAATTGGGATGATTATAACTCGAGTTATAATCATCCCAATTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000408.4-2701s21c1
Sequence:CCGGCAGATAGCATGTGTTATTAAACTCGAGTTTAATAACACATGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-2043s21c1
Sequence:CCGGGCAGACCAGAAAGGCTTTATTCTCGAGAATAAAGCCTTTCTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-2071s1c1
Sequence:CCGGCGTGTATTAGAGAGTATCAATCTCGAGATTGATACTCTCTAATACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-496s1c1
Sequence:CCGGGCCATCATGAAGTTGGATATTCTCGAGAATATCCAACTTCATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000408.1-1986s1c1
Sequence:CCGGGCCTTCAGACATTGACAGGTACTCGAGTACCTGTCAATGTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-1552s1c1
Sequence:CCGGCCCACACTCTACATTAGGCTTCTCGAGAAGCCTAATGTAGAGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-695s1c1
Sequence:CCGGGCAGTTATGTCCTCAGCAAATCTCGAGATTTGCTGAGGACATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000408
VALIDATED
GPD2 MISSION shRNA Lentiviral Transduction Particles
glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-1461s21c1
Sequence:CCGGATGGCAGAAGATACCATAAATCTCGAGATTTATGGTATCTTCTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-785s21c1
Sequence:CCGCCTACTATGACGGACAACATAACTCGAGTTATGTTGTCCGTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-563s21c1
Sequence:CCGGGCGTGCCAACCTGCTAGAAATCTCGAGATTTCTAGCAGGTTGGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-1874s21c1
Sequence:CCGGACTGAATTGGGATGATTATAACTCGAGTTATAATCATCCCAATTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000408.4-2701s21c1
Sequence:CCGGCAGATAGCATGTGTTATTAAACTCGAGTTTAATAACACATGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000408.4-2043s21c1
Sequence:CCGGGCAGACCAGAAAGGCTTTATTCTCGAGAATAAAGCCTTTCTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-2071s1c1
Sequence:CCGGCGTGTATTAGAGAGTATCAATCTCGAGATTGATACTCTCTAATACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-496s1c1
Sequence:CCGGGCCATCATGAAGTTGGATATTCTCGAGAATATCCAACTTCATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000408.1-1986s1c1
Sequence:CCGGGCCTTCAGACATTGACAGGTACTCGAGTACCTGTCAATGTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-1552s1c1
Sequence:CCGGCCCACACTCTACATTAGGCTTCTCGAGAAGCCTAATGTAGAGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000408.1-695s1c1
Sequence:CCGGGCAGTTATGTCCTCAGCAAATCTCGAGATTTGCTGAGGACATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks