EMAIL THIS PAGE TO A FRIEND

GPER1

G protein-coupled estrogen receptor 1

67 Gene Product Result for
Synonyms: CEPR CMKRL2 DRY12 FEG-1 GPCR-Br GPER GPR30 LERGU LERGU2 LyGPR
Gene ID:
Human(2852) Summary: This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein that localizes to the endoplasmic reticulum. The protein binds estrogen, resulting in intracellular calcium mobilization and synthesis of phosphatidylinositol 3,4,5-trisphosphate in the nucleus. This protein therefore plays a role in the rapid nongenomic signaling events widely observed following stimulation of cells and tissues with estrogen. Alternate transcriptional splice variants which encode the same protein have been characterized. [provided by RefSeq, Jul 2008]
Mouse(76854) G protein-coupled estrogen receptor 1
Zebrafish(565271) G protein-coupled estrogen receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_355659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001505 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010191 MISSION® esiRNA esiRNA targeting mouse Gper (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039966 Rosetta Predictions human pricing
NM_001098201 Rosetta Predictions human pricing
NM_001505 Rosetta Predictions human pricing
NM_029771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156961 predicted 2086
2 SASI_Hs02_00308735 predicted 2342
3 SASI_Hs01_00156962 predicted 1487
4 SASI_Hs01_00156963 predicted 2037
5 SASI_Hs01_00156964 predicted 1209
6 SASI_Hs01_00156965 predicted 1325
7 SASI_Hs01_00156966 predicted 1116
8 SASI_Hs01_00156967 predicted 1047
9 SASI_Hs01_00156968 predicted 1917
10 SASI_Hs01_00156969 predicted 2057
11 SASI_Hs01_00156970 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318628 predicted 1760
2 SASI_Hs02_00318629 predicted 2017
3 SASI_Hs02_00318630 predicted 1165
4 SASI_Hs02_00318631 predicted 1711
5 SASI_Hs02_00318632 predicted 887
6 SASI_Hs02_00318633 predicted 1003
7 SASI_Hs02_00318634 predicted 788
8 SASI_Hs02_00318635 predicted 729
9 SASI_Hs02_00318636 predicted 1596
10 SASI_Hs02_00318637 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172153 predicted 1955
2 SASI_Hs02_00331996 predicted 2218
3 SASI_Hs01_00172154 predicted 1371
4 SASI_Hs01_00172155 predicted 1913
5 SASI_Hs01_00172156 predicted 1085
6 SASI_Hs01_00172157 predicted 1206
7 SASI_Hs01_00172158 predicted 994
8 SASI_Hs01_00172159 predicted 924
9 SASI_Hs01_00172160 predicted 1792
10 SASI_Hs01_00172161 predicted 1929
11 SASI_Hs01_00172162 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335916 predicted 2092
2 SASI_Mm01_00175796 predicted 2060
3 SASI_Mm01_00175797 predicted 2108
4 SASI_Mm01_00175798 predicted 2153
5 SASI_Mm01_00175799 predicted 1914
6 SASI_Mm01_00175800 predicted 820
7 SASI_Mm01_00175801 predicted 2015
8 SASI_Mm01_00175802 predicted 1809
9 SASI_Mm01_00175804 predicted 1494
10 SASI_Mm01_00175805 predicted 2124
11 SASI_Mm01_00175803 predicted 2139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355659
GPER1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled estrogen receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1551s1c1
Sequence:CCGGACAGGCCACATAGTCAACCTTCTCGAGAAGGTTGACTATGTGGCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1252s1c1
Sequence:CCGGGCTTCTGCTTTGCTGATGTCACTCGAGTGACATCAGCAAAGCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-789s1c1
Sequence:CCGGGAGCATCAGCAGTACGTGATTCTCGAGAATCACGTACTGCTGATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1454s1c1
Sequence:CCGGGCTGCCGGAGAACGTCTTCATCTCGAGATGAAGACGTTCTCCGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1698s1c1
Sequence:CCGGGCCACGCTCAAGGCCGTCATTCTCGAGAATGACGGCCTTGAGCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355659
GPER1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled estrogen receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1551s1c1
Sequence:CCGGACAGGCCACATAGTCAACCTTCTCGAGAAGGTTGACTATGTGGCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1252s1c1
Sequence:CCGGGCTTCTGCTTTGCTGATGTCACTCGAGTGACATCAGCAAAGCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-789s1c1
Sequence:CCGGGAGCATCAGCAGTACGTGATTCTCGAGAATCACGTACTGCTGATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1454s1c1
Sequence:CCGGGCTGCCGGAGAACGTCTTCATCTCGAGATGAAGACGTTCTCCGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1698s1c1
Sequence:CCGGGCCACGCTCAAGGCCGTCATTCTCGAGAATGACGGCCTTGAGCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355659
GPER1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled estrogen receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1551s1c1
Sequence:CCGGACAGGCCACATAGTCAACCTTCTCGAGAAGGTTGACTATGTGGCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1252s1c1
Sequence:CCGGGCTTCTGCTTTGCTGATGTCACTCGAGTGACATCAGCAAAGCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-789s1c1
Sequence:CCGGGAGCATCAGCAGTACGTGATTCTCGAGAATCACGTACTGCTGATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1454s1c1
Sequence:CCGGGCTGCCGGAGAACGTCTTCATCTCGAGATGAAGACGTTCTCCGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355659.1-1698s1c1
Sequence:CCGGGCCACGCTCAAGGCCGTCATTCTCGAGAATGACGGCCTTGAGCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001505
VALIDATED
GPER1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled estrogen receptor 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-1751s1c1
Sequence:CCGGGCTGCCCTGAAGGCCGTCATTCTCGAGAATGACGGCCTTCAGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001505.1-2341s1c1
Sequence:CCGGCGAGTTAAAGAGGAGAAGGAACTCGAGTTCCTTCTCCTCTTTAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-1024s1c1
Sequence:CCGGCTCCCTCATTGAGGTGTTCAACTCGAGTTGAACACCTCAATGAGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-850s1c1
Sequence:CCGGGCAGTACGTGATCGGCCTGTTCTCGAGAACAGGCCGATCACGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-1564s1c1
Sequence:CCGGCGCTCCCTGCAAGCAGTCTTTCTCGAGAAAGACTGCTTGCAGGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1578s21c1
Sequence:CCGGTGCCGGAGAACGTCTTCATCACTCGAGTGATGAAGACGTTCTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1009s21c1
Sequence:CCGGGAACATCAGCTTCCGCGAGAACTCGAGTTCTCGCGGAAGCTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1040s21c1
Sequence:CCGGCCCGACCTGTACTTCATCAACCTCGAGGTTGATGAAGTACAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001505.2-2278s21c1
Sequence:CCGGAGTTACACAGGAACCCTAAAGCTCGAGCTTTAGGGTTCCTGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1758s21c1
Sequence:CCGGACAAGCTGAGGCTGTACATTGCTCGAGCAATGTACAGCCTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001505.2-1211s21c1
Sequence:CCGGATGAGCTTCGACCGCTACATCCTCGAGGATGTAGCGGTCGAAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001505.2-974s21c1
Sequence:CCGGATCGGCTTTGTGGGCAACATCCTCGAGGATGTTGCCCACAAAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001505.2-942s21c1
Sequence:CCGGTCTCGTGCCTCTACACCATCTCTCGAGAGATGGTGTAGAGGCACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001505.2-1960s21c1
Sequence:CCGGCGGCCACGTCATGTCTCTAAACTCGAGTTTAGAGACATGACGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001505
VALIDATED
GPER1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled estrogen receptor 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-1751s1c1
Sequence:CCGGGCTGCCCTGAAGGCCGTCATTCTCGAGAATGACGGCCTTCAGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001505.1-2341s1c1
Sequence:CCGGCGAGTTAAAGAGGAGAAGGAACTCGAGTTCCTTCTCCTCTTTAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-1024s1c1
Sequence:CCGGCTCCCTCATTGAGGTGTTCAACTCGAGTTGAACACCTCAATGAGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-850s1c1
Sequence:CCGGGCAGTACGTGATCGGCCTGTTCTCGAGAACAGGCCGATCACGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-1564s1c1
Sequence:CCGGCGCTCCCTGCAAGCAGTCTTTCTCGAGAAAGACTGCTTGCAGGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1578s21c1
Sequence:CCGGTGCCGGAGAACGTCTTCATCACTCGAGTGATGAAGACGTTCTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1009s21c1
Sequence:CCGGGAACATCAGCTTCCGCGAGAACTCGAGTTCTCGCGGAAGCTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1040s21c1
Sequence:CCGGCCCGACCTGTACTTCATCAACCTCGAGGTTGATGAAGTACAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001505.2-2278s21c1
Sequence:CCGGAGTTACACAGGAACCCTAAAGCTCGAGCTTTAGGGTTCCTGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1758s21c1
Sequence:CCGGACAAGCTGAGGCTGTACATTGCTCGAGCAATGTACAGCCTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001505.2-1211s21c1
Sequence:CCGGATGAGCTTCGACCGCTACATCCTCGAGGATGTAGCGGTCGAAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001505.2-974s21c1
Sequence:CCGGATCGGCTTTGTGGGCAACATCCTCGAGGATGTTGCCCACAAAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001505.2-942s21c1
Sequence:CCGGTCTCGTGCCTCTACACCATCTCTCGAGAGATGGTGTAGAGGCACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001505.2-1960s21c1
Sequence:CCGGCGGCCACGTCATGTCTCTAAACTCGAGTTTAGAGACATGACGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001505
VALIDATED
GPER1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled estrogen receptor 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-1751s1c1
Sequence:CCGGGCTGCCCTGAAGGCCGTCATTCTCGAGAATGACGGCCTTCAGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001505.1-2341s1c1
Sequence:CCGGCGAGTTAAAGAGGAGAAGGAACTCGAGTTCCTTCTCCTCTTTAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-1024s1c1
Sequence:CCGGCTCCCTCATTGAGGTGTTCAACTCGAGTTGAACACCTCAATGAGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-850s1c1
Sequence:CCGGGCAGTACGTGATCGGCCTGTTCTCGAGAACAGGCCGATCACGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001505.1-1564s1c1
Sequence:CCGGCGCTCCCTGCAAGCAGTCTTTCTCGAGAAAGACTGCTTGCAGGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1578s21c1
Sequence:CCGGTGCCGGAGAACGTCTTCATCACTCGAGTGATGAAGACGTTCTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1009s21c1
Sequence:CCGGGAACATCAGCTTCCGCGAGAACTCGAGTTCTCGCGGAAGCTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1040s21c1
Sequence:CCGGCCCGACCTGTACTTCATCAACCTCGAGGTTGATGAAGTACAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001505.2-2278s21c1
Sequence:CCGGAGTTACACAGGAACCCTAAAGCTCGAGCTTTAGGGTTCCTGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001505.2-1758s21c1
Sequence:CCGGACAAGCTGAGGCTGTACATTGCTCGAGCAATGTACAGCCTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001505.2-1211s21c1
Sequence:CCGGATGAGCTTCGACCGCTACATCCTCGAGGATGTAGCGGTCGAAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001505.2-974s21c1
Sequence:CCGGATCGGCTTTGTGGGCAACATCCTCGAGGATGTTGCCCACAAAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001505.2-942s21c1
Sequence:CCGGTCTCGTGCCTCTACACCATCTCTCGAGAGATGGTGTAGAGGCACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001505.2-1960s21c1
Sequence:CCGGCGGCCACGTCATGTCTCTAAACTCGAGTTTAGAGACATGACGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks