EMAIL THIS PAGE TO A FRIEND

GPHA2

glycoprotein hormone alpha 2

44 Gene Product Result for
Synonyms: A2 GPA2 ZSIG51
UniProtKB ID: Q96T91, Q52LE2
Gene ID:
Human(170589) Summary: GPHA2 is a cystine knot-forming polypeptide and a subunit of the dimeric glycoprotein hormone family (Hsu et al., 2002 [PubMed 12089349]
Mouse(170458) glycoprotein hormone alpha 2
Rat(171158) glycoprotein hormone alpha 2
sheep(101119430) glycoprotein hormone alpha 2
domestic guinea pig(100721321) glycoprotein hormone alpha 2
naked mole-rat(101706500) glycoprotein hormone alpha 2
Zebrafish(100310882) glycoprotein hormone alpha 2
cow(617578) glycoprotein hormone alpha 2
domestic cat(101081412) glycoprotein hormone alpha 2
dog(612085) glycoprotein hormone alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302124 ANTI-GPHA2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130769 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130769 Rosetta Predictions human pricing
NM_133619 Rosetta Predictions rat pricing
NM_130453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116220 predicted 404
2 SASI_Hs01_00116221 predicted 467
3 SASI_Hs01_00116222 predicted 239
4 SASI_Hs01_00116223 predicted 405
5 SASI_Hs01_00116224 predicted 242
6 SASI_Hs01_00116225 predicted 279
7 SASI_Hs01_00116226 predicted 371
8 SASI_Hs01_00116227 predicted 471
9 SASI_Hs01_00116228 predicted 403
10 SASI_Hs01_00116229 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038887 predicted 395
2 SASI_Rn01_00038888 predicted 387
3 SASI_Rn01_00038889 predicted 376
4 SASI_Rn02_00267844 predicted 457
5 SASI_Rn01_00038890 predicted 202
6 SASI_Rn02_00267845 predicted 379
7 SASI_Rn01_00038891 predicted 375
8 SASI_Rn01_00038892 predicted 432
9 SASI_Rn02_00267846 predicted 369
10 SASI_Rn01_00038893 predicted 416
11 SASI_Rn01_00038894 predicted 255
12 SASI_Rn01_00038895 predicted 427
13 SASI_Rn01_00038896 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201557 predicted 256
2 SASI_Mm01_00201558 predicted 216
3 SASI_Mm01_00201559 predicted 201
4 SASI_Mm01_00201560 predicted 251
5 SASI_Mm01_00201561 predicted 204
6 SASI_Mm01_00201562 predicted 354
7 SASI_Mm01_00201563 predicted 264
8 SASI_Mm01_00201564 predicted 209
9 SASI_Mm01_00201565 predicted 355
10 SASI_Mm01_00201566 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130453
GPHA2 MISSION shRNA Bacterial Glycerol Stock
glycoprotein hormone alpha 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130453.2-453s21c1
Sequence:CCGGACTGACATGTCATGGGTATCTCTCGAGAGATACCCATGACATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-358s21c1
Sequence:CCGGGGGAGCTTGAGATCTTTACTGCTCGAGCAGTAAAGATCTCAAGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-204s21c1
Sequence:CCGGGTAGGACACTGTGAGTCTAGTCTCGAGACTAGACTCACAGTGTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-392s21c1
Sequence:CCGGGTGTGATATGTGCCGTTTCTCCTCGAGGAGAAACGGCACATATCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-257s21c1
Sequence:CCGGCAGTGGCTATCGGCACAACATCTCGAGATGTTGTGCCGATAGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130453.2-202s1c1
Sequence:CCGGGTGTAGGACACTGTGAGTCTACTCGAGTAGACTCACAGTGTCCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130453.2-360s1c1
Sequence:CCGGGAGCTTGAGATCTTTACTGCACTCGAGTGCAGTAAAGATCTCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130453
GPHA2 MISSION shRNA shRNA Plasmid DNA
glycoprotein hormone alpha 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130453.2-453s21c1
Sequence:CCGGACTGACATGTCATGGGTATCTCTCGAGAGATACCCATGACATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-358s21c1
Sequence:CCGGGGGAGCTTGAGATCTTTACTGCTCGAGCAGTAAAGATCTCAAGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-204s21c1
Sequence:CCGGGTAGGACACTGTGAGTCTAGTCTCGAGACTAGACTCACAGTGTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-392s21c1
Sequence:CCGGGTGTGATATGTGCCGTTTCTCCTCGAGGAGAAACGGCACATATCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-257s21c1
Sequence:CCGGCAGTGGCTATCGGCACAACATCTCGAGATGTTGTGCCGATAGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130453.2-202s1c1
Sequence:CCGGGTGTAGGACACTGTGAGTCTACTCGAGTAGACTCACAGTGTCCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130453.2-360s1c1
Sequence:CCGGGAGCTTGAGATCTTTACTGCACTCGAGTGCAGTAAAGATCTCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130453
GPHA2 MISSION shRNA Lentiviral Transduction Particles
glycoprotein hormone alpha 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130453.2-453s21c1
Sequence:CCGGACTGACATGTCATGGGTATCTCTCGAGAGATACCCATGACATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-358s21c1
Sequence:CCGGGGGAGCTTGAGATCTTTACTGCTCGAGCAGTAAAGATCTCAAGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-204s21c1
Sequence:CCGGGTAGGACACTGTGAGTCTAGTCTCGAGACTAGACTCACAGTGTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-392s21c1
Sequence:CCGGGTGTGATATGTGCCGTTTCTCCTCGAGGAGAAACGGCACATATCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130453.2-257s21c1
Sequence:CCGGCAGTGGCTATCGGCACAACATCTCGAGATGTTGTGCCGATAGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130453.2-202s1c1
Sequence:CCGGGTGTAGGACACTGTGAGTCTACTCGAGTAGACTCACAGTGTCCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130453.2-360s1c1
Sequence:CCGGGAGCTTGAGATCTTTACTGCACTCGAGTGCAGTAAAGATCTCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130769
GPHA2 MISSION shRNA Bacterial Glycerol Stock
glycoprotein hormone alpha 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130769.2-596s1c1
Sequence:CCGGGCTTTGATCCTTTGTAAGATTCTCGAGAATCTTACAAAGGATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130769.2-542s1c1
Sequence:CCGGGCCCTGATGGTTACTTGCTATCTCGAGATAGCAAGTAACCATCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130769.2-280s1c1
Sequence:CCGGCAGTGGTTACCGACACAACATCTCGAGATGTTGTGTCGGTAACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130769.2-337s1c1
Sequence:CCGGGAAGAAGGTCAAAGTACAGCTCTCGAGAGCTGTACTTTGACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130769.2-547s1c1
Sequence:CCGGGATGGTTACTTGCTATGGAATCTCGAGATTCCATAGCAAGTAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130769
GPHA2 MISSION shRNA shRNA Plasmid DNA
glycoprotein hormone alpha 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130769.2-596s1c1
Sequence:CCGGGCTTTGATCCTTTGTAAGATTCTCGAGAATCTTACAAAGGATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130769.2-542s1c1
Sequence:CCGGGCCCTGATGGTTACTTGCTATCTCGAGATAGCAAGTAACCATCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130769.2-280s1c1
Sequence:CCGGCAGTGGTTACCGACACAACATCTCGAGATGTTGTGTCGGTAACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130769.2-337s1c1
Sequence:CCGGGAAGAAGGTCAAAGTACAGCTCTCGAGAGCTGTACTTTGACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130769.2-547s1c1
Sequence:CCGGGATGGTTACTTGCTATGGAATCTCGAGATTCCATAGCAAGTAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130769
GPHA2 MISSION shRNA Lentiviral Transduction Particles
glycoprotein hormone alpha 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130769.2-596s1c1
Sequence:CCGGGCTTTGATCCTTTGTAAGATTCTCGAGAATCTTACAAAGGATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130769.2-542s1c1
Sequence:CCGGGCCCTGATGGTTACTTGCTATCTCGAGATAGCAAGTAACCATCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130769.2-280s1c1
Sequence:CCGGCAGTGGTTACCGACACAACATCTCGAGATGTTGTGTCGGTAACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130769.2-337s1c1
Sequence:CCGGGAAGAAGGTCAAAGTACAGCTCTCGAGAGCTGTACTTTGACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130769.2-547s1c1
Sequence:CCGGGATGGTTACTTGCTATGGAATCTCGAGATTCCATAGCAAGTAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks