EMAIL THIS PAGE TO A FRIEND

GPHB5

glycoprotein hormone beta 5

61 Gene Product Result for
Synonyms: B5 GPB5 ZLUT1
UniProtKB ID: Q86YW7, Q6NTD0, Q8NFW2
Gene ID:
Human(122876) Summary: GPHB5 is a cystine knot-forming polypeptide and a subunit of the dimeric glycoprotein hormone family (Hsu et al., 2002 [PubMed 12089349]
Mouse(217674) glycoprotein hormone beta 5
Rat(366668) glycoprotein hormone beta 5
Zebrafish(100310830) glycoprotein hormone beta 5
cow(539408) glycoprotein hormone beta 5
domestic cat(101085046) glycoprotein hormone beta 5
dog(490726) glycoprotein hormone beta 5
chicken(776157) glycoprotein hormone beta 5
domestic guinea pig(100725310) glycoprotein hormone beta 5
naked mole-rat(101712660) glycoprotein hormone beta 5
sheep(101107526) glycoprotein hormone beta 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301417 ANTI-GPHB5 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145171 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090771 MISSION® esiRNA esiRNA targeting mouse Gphb5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145171 Rosetta Predictions human pricing
NM_001007013 Rosetta Predictions rat pricing
XM_579168 Rosetta Predictions rat pricing
NM_175644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116915 predicted 104
2 SASI_Hs01_00116916 predicted 323
3 SASI_Hs01_00116917 predicted 79
4 SASI_Hs01_00116918 predicted 239
5 SASI_Hs02_00365025 predicted 233
6 SASI_Hs02_00365026 predicted 241
7 SASI_Hs01_00116919 predicted 233
8 SASI_Hs01_00116920 predicted 96
9 SASI_Hs01_00116921 predicted 258
10 SASI_Hs01_00116922 predicted 230
11 SASI_Hs01_00116923 predicted 182
12 SASI_Hs01_00116924 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069573 predicted 230
2 SASI_Rn01_00069574 predicted 94
3 SASI_Rn01_00069575 predicted 318
4 SASI_Rn01_00069576 predicted 215
5 SASI_Rn02_00198604 predicted 215
6 SASI_Rn01_00069577 predicted 91
7 SASI_Rn01_00069578 predicted 268
8 SASI_Rn01_00069580 predicted 230
9 SASI_Rn01_00069581 predicted 246
10 SASI_Rn01_00069582 predicted 269
11 SASI_Rn01_00069579 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122967 predicted 243
2 SASI_Rn01_00122968 predicted 95
3 SASI_Rn01_00122969 predicted 324
4 SASI_Rn01_00122970 predicted 219
5 SASI_Rn01_00122971 predicted 102
6 SASI_Rn01_00122972 predicted 270
7 SASI_Rn01_00122973 predicted 235
8 SASI_Rn01_00122974 predicted 234
9 SASI_Rn01_00122975 predicted 253
10 SASI_Rn01_00122976 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346572 predicted 651
2 SASI_Mm01_00028940 predicted 855
3 SASI_Mm01_00028941 predicted 863
4 SASI_Mm01_00028943 predicted 339
5 SASI_Mm01_00028944 predicted 417
6 SASI_Mm02_00346573 predicted 379
7 SASI_Mm01_00028945 predicted 223
8 SASI_Mm01_00028946 predicted 864
9 SASI_Mm01_00028947 predicted 864
10 SASI_Mm02_00346574 predicted 782
11 SASI_Mm01_00028942 predicted 559
12 SASI_Mm01_00028948 predicted 608
13 SASI_Mm01_00028949 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145171
GPHB5 MISSION shRNA Bacterial Glycerol Stock
glycoprotein hormone beta 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145171.2-118s1c1
Sequence:CCGGGAGTTTACTTTCCTGGCCAAGCTCGAGCTTGGCCAGGAAAGTAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145171.2-120s1c1
Sequence:CCGGGTTTACTTTCCTGGCCAAGAACTCGAGTTCTTGGCCAGGAAAGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-193s21c1
Sequence:CCGGAGACCTGGCAGAAACCCATTCCTCGAGGAATGGGTTTCTGCCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-120s21c1
Sequence:CCGGGTTTACTTTCCTGGCCAAGAACTCGAGTTCTTGGCCAGGAAAGTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-79s21c1
Sequence:CCGGAGTGGGAACCTGCGCACCTTTCTCGAGAAAGGTGCGCAGGTTCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-222s21c1
Sequence:CCGGCCCTATATTGAAGCCCATCATCTCGAGATGATGGGCTTCAATATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-109s21c1
Sequence:CCGGGCCGTGAGGGAGTTTACTTTCCTCGAGGAAAGTAAACTCCCTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145171
GPHB5 MISSION shRNA shRNA Plasmid DNA
glycoprotein hormone beta 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145171.2-118s1c1
Sequence:CCGGGAGTTTACTTTCCTGGCCAAGCTCGAGCTTGGCCAGGAAAGTAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145171.2-120s1c1
Sequence:CCGGGTTTACTTTCCTGGCCAAGAACTCGAGTTCTTGGCCAGGAAAGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-193s21c1
Sequence:CCGGAGACCTGGCAGAAACCCATTCCTCGAGGAATGGGTTTCTGCCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-120s21c1
Sequence:CCGGGTTTACTTTCCTGGCCAAGAACTCGAGTTCTTGGCCAGGAAAGTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-79s21c1
Sequence:CCGGAGTGGGAACCTGCGCACCTTTCTCGAGAAAGGTGCGCAGGTTCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-222s21c1
Sequence:CCGGCCCTATATTGAAGCCCATCATCTCGAGATGATGGGCTTCAATATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-109s21c1
Sequence:CCGGGCCGTGAGGGAGTTTACTTTCCTCGAGGAAAGTAAACTCCCTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145171
GPHB5 MISSION shRNA Lentiviral Transduction Particles
glycoprotein hormone beta 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145171.2-118s1c1
Sequence:CCGGGAGTTTACTTTCCTGGCCAAGCTCGAGCTTGGCCAGGAAAGTAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145171.2-120s1c1
Sequence:CCGGGTTTACTTTCCTGGCCAAGAACTCGAGTTCTTGGCCAGGAAAGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-193s21c1
Sequence:CCGGAGACCTGGCAGAAACCCATTCCTCGAGGAATGGGTTTCTGCCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-120s21c1
Sequence:CCGGGTTTACTTTCCTGGCCAAGAACTCGAGTTCTTGGCCAGGAAAGTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-79s21c1
Sequence:CCGGAGTGGGAACCTGCGCACCTTTCTCGAGAAAGGTGCGCAGGTTCCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-222s21c1
Sequence:CCGGCCCTATATTGAAGCCCATCATCTCGAGATGATGGGCTTCAATATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145171.2-109s21c1
Sequence:CCGGGCCGTGAGGGAGTTTACTTTCCTCGAGGAAAGTAAACTCCCTCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175644
GPHB5 MISSION shRNA Bacterial Glycerol Stock
glycoprotein hormone beta 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175644.1-1357s1c1
Sequence:CCGGCCGGAGTGTTTACAGCAGTAACTCGAGTTACTGCTGTAAACACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-352s1c1
Sequence:CCGGCCTATCATCGAGTGTGTACATCTCGAGATGTACACACTCGATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-428s1c1
Sequence:CCGGTCCTTTCTACACCTACCCTATCTCGAGATAGGGTAGGTGTAGAAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-336s1c1
Sequence:CCGGCCTCCCTACATTGAAGCCTATCTCGAGATAGGCTTCAATGTAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-485s1c1
Sequence:CCGGCACCACTGAGTGTGAGACCATCTCGAGATGGTCTCACACTCAGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175644
GPHB5 MISSION shRNA shRNA Plasmid DNA
glycoprotein hormone beta 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175644.1-1357s1c1
Sequence:CCGGCCGGAGTGTTTACAGCAGTAACTCGAGTTACTGCTGTAAACACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-352s1c1
Sequence:CCGGCCTATCATCGAGTGTGTACATCTCGAGATGTACACACTCGATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-428s1c1
Sequence:CCGGTCCTTTCTACACCTACCCTATCTCGAGATAGGGTAGGTGTAGAAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-336s1c1
Sequence:CCGGCCTCCCTACATTGAAGCCTATCTCGAGATAGGCTTCAATGTAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-485s1c1
Sequence:CCGGCACCACTGAGTGTGAGACCATCTCGAGATGGTCTCACACTCAGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175644
GPHB5 MISSION shRNA Lentiviral Transduction Particles
glycoprotein hormone beta 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175644.1-1357s1c1
Sequence:CCGGCCGGAGTGTTTACAGCAGTAACTCGAGTTACTGCTGTAAACACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-352s1c1
Sequence:CCGGCCTATCATCGAGTGTGTACATCTCGAGATGTACACACTCGATGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-428s1c1
Sequence:CCGGTCCTTTCTACACCTACCCTATCTCGAGATAGGGTAGGTGTAGAAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-336s1c1
Sequence:CCGGCCTCCCTACATTGAAGCCTATCTCGAGATAGGCTTCAATGTAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175644.1-485s1c1
Sequence:CCGGCACCACTGAGTGTGAGACCATCTCGAGATGGTCTCACACTCAGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)