EMAIL THIS PAGE TO A FRIEND

GPHN

gephyrin

126 Gene Product Result for
Synonyms: GEPH GPH GPHRYN HKPX1
UniProtKB ID: Q9NQX3, Q9H4E9, Q9P2G2
Gene ID:
Human(10243) Summary: This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
Mouse(268566) gephyrin
Rat(64845) gephyrin
sheep(101112228) gephyrin
chicken(428878) gephyrin
dog(490739) gephyrin
cow(535194) gephyrin
Horse(100063078) gephyrin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020806 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024218 Rosetta Predictions human pricing
NM_020806 Rosetta Predictions human pricing
NM_022865 Rosetta Predictions rat pricing
XM_579467 Rosetta Predictions rat pricing
NM_172952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307117 predicted 2589
2 SASI_Hs01_00043430 predicted 1154
3 SASI_Hs02_00307118 predicted 3322
4 SASI_Hs01_00043432 predicted 2737
5 SASI_Hs01_00043433 predicted 3380
6 SASI_Hs01_00043434 predicted 3167
7 SASI_Hs01_00043435 predicted 1227
8 SASI_Hs01_00043437 predicted 3362
9 SASI_Hs01_00043438 predicted 2082
10 SASI_Hs02_00307119 predicted 2553
11 SASI_Hs01_00043431 predicted 1350
12 SASI_Hs01_00043436 predicted 3090
13 SASI_Hs01_00043439 predicted 2638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353982 predicted 2692
2 SASI_Hs01_00118348 predicted 1154
3 SASI_Hs02_00353983 predicted 3417
4 SASI_Hs01_00118350 predicted 2841
5 SASI_Hs01_00118351 predicted 3478
6 SASI_Hs01_00118352 predicted 3271
7 SASI_Hs01_00118353 predicted 1218
8 SASI_Hs01_00118355 predicted 3463
9 SASI_Hs01_00118356 predicted 2184
10 SASI_Hs02_00353984 predicted 2654
11 SASI_Hs01_00118349 predicted 1351
12 SASI_Hs01_00118354 predicted 3192
13 SASI_Hs01_00118357 predicted 2737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107585 predicted 1720
2 SASI_Rn01_00107586 predicted 1440
3 SASI_Rn01_00107587 predicted 1978
4 SASI_Rn01_00107589 predicted 2206
5 SASI_Rn02_00263597 predicted 2161
6 SASI_Rn02_00263598 predicted 2366
7 SASI_Rn01_00107590 predicted 1954
8 SASI_Rn01_00107591 predicted 2387
9 SASI_Rn02_00263599 predicted 2295
10 SASI_Rn02_00263600 predicted 492
11 SASI_Rn01_00107588 predicted 314
12 SASI_Rn01_00107592 predicted 1816
13 SASI_Rn01_00107593 predicted 1496
14 SASI_Rn01_00107594 predicted 2243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140917 predicted 852
2 SASI_Rn01_00140918 predicted 1108
3 SASI_Rn01_00140919 predicted 1337
4 SASI_Rn01_00140920 predicted 1296
5 SASI_Rn01_00140921 predicted 1503
6 SASI_Rn01_00140922 predicted 1242
7 SASI_Rn01_00140923 predicted 1094
8 SASI_Rn01_00140924 predicted 1521
9 SASI_Rn01_00140925 predicted 826
10 SASI_Rn01_00140926 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111113 predicted 1717
2 SASI_Mm01_00111114 predicted 1442
3 SASI_Mm01_00111116 predicted 2114
4 SASI_Mm01_00111117 predicted 2201
5 SASI_Mm02_00344988 predicted 1975
6 SASI_Mm01_00111118 predicted 2162
7 SASI_Mm01_00111119 predicted 974
8 SASI_Mm01_00111120 predicted 1104
9 SASI_Mm01_00111121 predicted 1578
10 SASI_Mm02_00344989 predicted 246
11 SASI_Mm01_00111115 predicted 1976
12 SASI_Mm01_00111122 predicted 1208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020806
GPHN MISSION shRNA Bacterial Glycerol Stock
gephyrin
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-2126s21c1
Sequence:CCGGCAGTCACAGTGCTGTCGATATCTCGAGATATCGACAGCACTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-2498s21c1
Sequence:CCGGAGTGGAAGATACCGAACTTATCTCGAGATAAGTTCGGTATCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-1807s21c1
Sequence:CCGGATAGTTCCTCATCACATATAACTCGAGTTATATGTGATGAGGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020806.4-3885s21c1
Sequence:CCGGTCTCATGTATCTCGTGTTTATCTCGAGATAAACACGAGATACATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-2595s21c1
Sequence:CCGGCCCATCGGCCATGACATTAAACTCGAGTTTAATGTCATGGCCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-1215s21c1
Sequence:CCGGGAAGACCGCAGTGGGATAAATCTCGAGATTTATCCCACTGCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-3185s21c1
Sequence:CCGGCATCATCAAAGCAAGGTTATCCTCGAGGATAACCTTGCTTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020806.4-3544s21c1
Sequence:CCGGGTCAACATCTTGAACTATATTCTCGAGAATATAGTTCAAGATGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020806.3-2725s1c1
Sequence:CCGGCCTTCTTAGTATGCTTCATAACTCGAGTTATGAAGCATACTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-1729s1c1
Sequence:CCGGCCCACGATCAACTTGGGTATTCTCGAGAATACCCAAGTTGATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-65s1c1
Sequence:CCGGGAGTCCTTACAGTGAGTGATACTCGAGTATCACTCACTGTAAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-2122s1c1
Sequence:CCGGCCAGAATACCATCGGTGTATACTCGAGTATACACCGATGGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-2227s1c1
Sequence:CCGGGCCAATGGATTGTTGATGCTACTCGAGTAGCATCAACAATCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020806
GPHN MISSION shRNA shRNA Plasmid DNA
gephyrin
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-2126s21c1
Sequence:CCGGCAGTCACAGTGCTGTCGATATCTCGAGATATCGACAGCACTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-2498s21c1
Sequence:CCGGAGTGGAAGATACCGAACTTATCTCGAGATAAGTTCGGTATCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-1807s21c1
Sequence:CCGGATAGTTCCTCATCACATATAACTCGAGTTATATGTGATGAGGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020806.4-3885s21c1
Sequence:CCGGTCTCATGTATCTCGTGTTTATCTCGAGATAAACACGAGATACATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-2595s21c1
Sequence:CCGGCCCATCGGCCATGACATTAAACTCGAGTTTAATGTCATGGCCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-1215s21c1
Sequence:CCGGGAAGACCGCAGTGGGATAAATCTCGAGATTTATCCCACTGCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-3185s21c1
Sequence:CCGGCATCATCAAAGCAAGGTTATCCTCGAGGATAACCTTGCTTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020806.4-3544s21c1
Sequence:CCGGGTCAACATCTTGAACTATATTCTCGAGAATATAGTTCAAGATGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020806.3-2725s1c1
Sequence:CCGGCCTTCTTAGTATGCTTCATAACTCGAGTTATGAAGCATACTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-1729s1c1
Sequence:CCGGCCCACGATCAACTTGGGTATTCTCGAGAATACCCAAGTTGATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-65s1c1
Sequence:CCGGGAGTCCTTACAGTGAGTGATACTCGAGTATCACTCACTGTAAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-2122s1c1
Sequence:CCGGCCAGAATACCATCGGTGTATACTCGAGTATACACCGATGGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-2227s1c1
Sequence:CCGGGCCAATGGATTGTTGATGCTACTCGAGTAGCATCAACAATCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020806
GPHN MISSION shRNA Lentiviral Transduction Particles
gephyrin
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-2126s21c1
Sequence:CCGGCAGTCACAGTGCTGTCGATATCTCGAGATATCGACAGCACTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-2498s21c1
Sequence:CCGGAGTGGAAGATACCGAACTTATCTCGAGATAAGTTCGGTATCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-1807s21c1
Sequence:CCGGATAGTTCCTCATCACATATAACTCGAGTTATATGTGATGAGGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020806.4-3885s21c1
Sequence:CCGGTCTCATGTATCTCGTGTTTATCTCGAGATAAACACGAGATACATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-2595s21c1
Sequence:CCGGCCCATCGGCCATGACATTAAACTCGAGTTTAATGTCATGGCCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-1215s21c1
Sequence:CCGGGAAGACCGCAGTGGGATAAATCTCGAGATTTATCCCACTGCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020806.4-3185s21c1
Sequence:CCGGCATCATCAAAGCAAGGTTATCCTCGAGGATAACCTTGCTTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020806.4-3544s21c1
Sequence:CCGGGTCAACATCTTGAACTATATTCTCGAGAATATAGTTCAAGATGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020806.3-2725s1c1
Sequence:CCGGCCTTCTTAGTATGCTTCATAACTCGAGTTATGAAGCATACTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-1729s1c1
Sequence:CCGGCCCACGATCAACTTGGGTATTCTCGAGAATACCCAAGTTGATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-65s1c1
Sequence:CCGGGAGTCCTTACAGTGAGTGATACTCGAGTATCACTCACTGTAAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-2122s1c1
Sequence:CCGGCCAGAATACCATCGGTGTATACTCGAGTATACACCGATGGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020806.3-2227s1c1
Sequence:CCGGGCCAATGGATTGTTGATGCTACTCGAGTAGCATCAACAATCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172952
VALIDATED
GPHN MISSION shRNA Bacterial Glycerol Stock
gephyrin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172952.2-388s21c1
Sequence:CCGGTGCTGATGGGATCGCTCAATGCTCGAGCATTGAGCGATCCCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172952.2-2253s21c1
Sequence:CCGGCGCAGTGCCAATGGATTATTGCTCGAGCAATAATCCATTGGCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172952.2-138s21c1
Sequence:CCGGGAAGACCGCAGTGGGATAAATCTCGAGATTTATCCCACTGCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172952.2-2154s21c1
Sequence:CCGGCCAGAATACCACCGGTGTATACTCGAGTATACACCGGTGGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172952.2-2758s21c1
Sequence:CCGGCCCTTCTTAGTATGCTTCATACTCGAGTATGAAGCATACTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172952.1-2108s1c1
Sequence:CCGGCCATCATCAAAGCCAGGTTATCTCGAGATAACCTGGCTTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172952.1-2759s1c1
Sequence:CCGGCCCTTCTTAGTATGCTTCATACTCGAGTATGAAGCATACTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172952.1-1761s1c1
Sequence:CCGGCCCAACAATCAACCTGGGAATCTCGAGATTCCCAGGTTGATTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172952.1-208s1c1
Sequence:CCGGGCATACAAGATAGTACCAGATCTCGAGATCTGGTACTATCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172952.1-485s1c1
Sequence:CCGGGCAAGAAAGGATCTCAGGAATCTCGAGATTCCTGAGATCCTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172952
VALIDATED
GPHN MISSION shRNA shRNA Plasmid DNA
gephyrin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172952.2-388s21c1
Sequence:CCGGTGCTGATGGGATCGCTCAATGCTCGAGCATTGAGCGATCCCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172952.2-2253s21c1
Sequence:CCGGCGCAGTGCCAATGGATTATTGCTCGAGCAATAATCCATTGGCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172952.2-138s21c1
Sequence:CCGGGAAGACCGCAGTGGGATAAATCTCGAGATTTATCCCACTGCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172952.2-2154s21c1
Sequence:CCGGCCAGAATACCACCGGTGTATACTCGAGTATACACCGGTGGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172952.2-2758s21c1
Sequence:CCGGCCCTTCTTAGTATGCTTCATACTCGAGTATGAAGCATACTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172952.1-2108s1c1
Sequence:CCGGCCATCATCAAAGCCAGGTTATCTCGAGATAACCTGGCTTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172952.1-2759s1c1
Sequence:CCGGCCCTTCTTAGTATGCTTCATACTCGAGTATGAAGCATACTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172952.1-1761s1c1
Sequence:CCGGCCCAACAATCAACCTGGGAATCTCGAGATTCCCAGGTTGATTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172952.1-208s1c1
Sequence:CCGGGCATACAAGATAGTACCAGATCTCGAGATCTGGTACTATCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172952.1-485s1c1
Sequence:CCGGGCAAGAAAGGATCTCAGGAATCTCGAGATTCCTGAGATCCTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172952
VALIDATED
GPHN MISSION shRNA Lentiviral Transduction Particles
gephyrin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172952.2-388s21c1
Sequence:CCGGTGCTGATGGGATCGCTCAATGCTCGAGCATTGAGCGATCCCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172952.2-2253s21c1
Sequence:CCGGCGCAGTGCCAATGGATTATTGCTCGAGCAATAATCCATTGGCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172952.2-138s21c1
Sequence:CCGGGAAGACCGCAGTGGGATAAATCTCGAGATTTATCCCACTGCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172952.2-2154s21c1
Sequence:CCGGCCAGAATACCACCGGTGTATACTCGAGTATACACCGGTGGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172952.2-2758s21c1
Sequence:CCGGCCCTTCTTAGTATGCTTCATACTCGAGTATGAAGCATACTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172952.1-2108s1c1
Sequence:CCGGCCATCATCAAAGCCAGGTTATCTCGAGATAACCTGGCTTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172952.1-2759s1c1
Sequence:CCGGCCCTTCTTAGTATGCTTCATACTCGAGTATGAAGCATACTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172952.1-1761s1c1
Sequence:CCGGCCCAACAATCAACCTGGGAATCTCGAGATTCCCAGGTTGATTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172952.1-208s1c1
Sequence:CCGGGCATACAAGATAGTACCAGATCTCGAGATCTGGTACTATCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172952.1-485s1c1
Sequence:CCGGGCAAGAAAGGATCTCAGGAATCTCGAGATTCCTGAGATCCTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks