EMAIL THIS PAGE TO A FRIEND

GPI

glucose-6-phosphate isomerase

44 Gene Product Result for
Synonyms: AMF GNPI NLK PGI PHI SA-36 SA36
UniProtKB ID: P06744, B4DG39, Q9BRD3, Q9BSK5, Q9UHE6
Gene ID:
Human(2821) Summary: This gene belongs to the GPI family whose members encode multifunctional phosphoglucose isomerase proteins involved in energy pathways. The protein encoded by this gene is a dimeric enzyme that catalyzes the reversible isomerization of glucose-6-phosphate and fructose-6-phosphate. The protein functions in different capacities inside and outside the cell. In the cytoplasm, the gene product is involved in glycolysis and gluconeogenesis, while outside the cell it functions as a neurotrophic factor for spinal and sensory neurons. Defects in this gene are the cause of nonspherocytic hemolytic anemia and a severe enzyme deficiency can be associated with hydrops fetalis, immediate neonatal death and neurological impairment. [provided by RefSeq, Jul 2008]
Rat(292804) glucose-6-phosphate isomerase
chicken(415783) glucose-6-phosphate isomerase
cow(280808) glucose-6-phosphate isomerase
Horse(100057160) glucose-6-phosphate isomerase
domestic cat(101082360) glucose-6-phosphate isomerase
dog(611942) glucose-6-phosphate isomerase
domestic guinea pig(100719769) glucose-6-phosphate isomerase
naked mole-rat(101720720) glucose-6-phosphate isomerase
sheep(101112413) glucose-6-phosphate isomerase
Domestic Rabbit(100008744) glucose-6-phosphate isomerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G0422 Anti-GPI (211-225) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501538 Anti-GPI antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, human
ELISA, western blot pricing
SAB2501539 Anti-GPI antibody produced in goat affinity isolated antibody, buffered aqueous solution human, pig
ELISA, western blot pricing
SAB1400115 Anti-GPI antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1400116 Anti-GPI antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
HPA024305 Anti-GPI antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1400117 Anti-GPI antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
HPA052171 Anti-GPI antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry, western blot pricing
SAB4100031 Monoclonal Anti-GPI antibody produced in mouse culture supernatant human
western blot pricing
SAB5300288 Monoclonal Anti-GPI antibody produced in mouse clone 1B7D7, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000175 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078901 MISSION® esiRNA esiRNA human GPI (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000175 Rosetta Predictions human pricing
NM_207592 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183220 predicted 248
2 SASI_Hs01_00183221 predicted 1520
3 SASI_Hs01_00183222 predicted 1192
4 SASI_Hs01_00183224 predicted 642
5 SASI_Hs01_00183225 predicted 863
6 SASI_Hs01_00183226 predicted 1502
7 SASI_Hs01_00183228 predicted 1252
8 SASI_Hs01_00183229 predicted 1296
9 SASI_Hs02_00302012 predicted 1313
10 SASI_Hs02_00302013 predicted 606
11 SASI_Hs01_00183223 predicted 271
12 SASI_Hs01_00183227 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108934 predicted 608
2 SASI_Rn01_00108935 predicted 562
3 SASI_Rn01_00108936 predicted 1682
4 SASI_Rn01_00108937 predicted 737
5 SASI_Rn01_00108938 predicted 230
6 SASI_Rn01_00108939 predicted 1509
7 SASI_Rn01_00108940 predicted 1532
8 SASI_Rn01_00108941 predicted 222
9 SASI_Rn01_00108942 predicted 1526
10 SASI_Rn02_00270410 predicted 1687
11 SASI_Rn01_00108943 predicted 817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000175
VALIDATED
GPI MISSION shRNA Bacterial Glycerol Stock
glucose-6-phosphate isomerase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000175.2-1069s1c1
Sequence:CCGGGCTGGGTATCTGGTACATCAACTCGAGTTGATGTACCAGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-1576s1c1
Sequence:CCGGCGCCATGTATGAGCACAAGATCTCGAGATCTTGTGCTCATACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-643s1c1
Sequence:CCGGCGTCTGGTATGTCTCCAACATCTCGAGATGTTGGAGACATACCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-838s1c1
Sequence:CCGGCCTGTCTACTAACACAACCAACTCGAGTTGGTTGTGTTAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-349s1c1
Sequence:CCGGGCGGATGTTCAATGGTGAGAACTCGAGTTCTCACCATTGAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-1576s21c1
Sequence:CCGGCGCCATGTATGAGCACAAGATCTCGAGATCTTGTGCTCATACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-643s21c1
Sequence:CCGGCGTCTGGTATGTCTCCAACATCTCGAGATGTTGGAGACATACCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-1069s21c1
Sequence:CCGGGCTGGGTATCTGGTACATCAACTCGAGTTGATGTACCAGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-349s21c1
Sequence:CCGGGCGGATGTTCAATGGTGAGAACTCGAGTTCTCACCATTGAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-838s21c1
Sequence:CCGGCCTGTCTACTAACACAACCAACTCGAGTTGGTTGTGTTAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000175
VALIDATED
GPI MISSION shRNA shRNA Plasmid DNA
glucose-6-phosphate isomerase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000175.2-1069s1c1
Sequence:CCGGGCTGGGTATCTGGTACATCAACTCGAGTTGATGTACCAGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-1576s1c1
Sequence:CCGGCGCCATGTATGAGCACAAGATCTCGAGATCTTGTGCTCATACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-643s1c1
Sequence:CCGGCGTCTGGTATGTCTCCAACATCTCGAGATGTTGGAGACATACCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-838s1c1
Sequence:CCGGCCTGTCTACTAACACAACCAACTCGAGTTGGTTGTGTTAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-349s1c1
Sequence:CCGGGCGGATGTTCAATGGTGAGAACTCGAGTTCTCACCATTGAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-1576s21c1
Sequence:CCGGCGCCATGTATGAGCACAAGATCTCGAGATCTTGTGCTCATACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-643s21c1
Sequence:CCGGCGTCTGGTATGTCTCCAACATCTCGAGATGTTGGAGACATACCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-1069s21c1
Sequence:CCGGGCTGGGTATCTGGTACATCAACTCGAGTTGATGTACCAGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-349s21c1
Sequence:CCGGGCGGATGTTCAATGGTGAGAACTCGAGTTCTCACCATTGAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-838s21c1
Sequence:CCGGCCTGTCTACTAACACAACCAACTCGAGTTGGTTGTGTTAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000175
VALIDATED
GPI MISSION shRNA Lentiviral Transduction Particles
glucose-6-phosphate isomerase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000175.2-1069s1c1
Sequence:CCGGGCTGGGTATCTGGTACATCAACTCGAGTTGATGTACCAGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-1576s1c1
Sequence:CCGGCGCCATGTATGAGCACAAGATCTCGAGATCTTGTGCTCATACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-643s1c1
Sequence:CCGGCGTCTGGTATGTCTCCAACATCTCGAGATGTTGGAGACATACCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-838s1c1
Sequence:CCGGCCTGTCTACTAACACAACCAACTCGAGTTGGTTGTGTTAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000175.2-349s1c1
Sequence:CCGGGCGGATGTTCAATGGTGAGAACTCGAGTTCTCACCATTGAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-1576s21c1
Sequence:CCGGCGCCATGTATGAGCACAAGATCTCGAGATCTTGTGCTCATACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-643s21c1
Sequence:CCGGCGTCTGGTATGTCTCCAACATCTCGAGATGTTGGAGACATACCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-1069s21c1
Sequence:CCGGGCTGGGTATCTGGTACATCAACTCGAGTTGATGTACCAGATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-349s21c1
Sequence:CCGGGCGGATGTTCAATGGTGAGAACTCGAGTTCTCACCATTGAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000175.2-838s21c1
Sequence:CCGGCCTGTCTACTAACACAACCAACTCGAGTTGGTTGTGTTAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks