EMAIL THIS PAGE TO A FRIEND

GPIHBP1

glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1

Synonyms: GPI-HBP1
UniProtKB ID: Q8IV16, Q6P3T2, Q86W15
Gene ID:
Human(338328) Summary: Dietary fats are packaged by intestine into triglyceride-rich lipoproteins called chylomicrons. The triglycerides in chylomicrons are hydrolyzed by lipoprotein lipase (LPL: MIM 609708) along the luminal surface of capillaries, mainly in heart, skeletal muscle, and adipose tissue. GPIHBP1 is a capillary endothelial cell protein that provides a platform for LPL-mediated processing of chylomicrons (Beigneux et al., 2007 [PubMed 17403372]
Mouse(68453) GPI-anchored HDL-binding protein 1
Rat(300027) glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
domestic guinea pig(100728022) glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
naked mole-rat(101697543) glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
cow(512826) glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
dog(609267) glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA066302 Anti-GPIHBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178172 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007951 MISSION® esiRNA esiRNA targeting human GPIHBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178172 Rosetta Predictions human pricing
NM_001130547 Rosetta Predictions rat pricing
NM_026730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181832 predicted 974
2 SASI_Hs01_00181834 predicted 707
3 SASI_Hs01_00181835 predicted 248
4 SASI_Hs01_00181836 predicted 793
5 SASI_Hs01_00181837 predicted 342
6 SASI_Hs01_00181838 predicted 706
7 SASI_Hs01_00181839 predicted 405
8 SASI_Hs01_00181840 predicted 718
9 SASI_Hs01_00181841 predicted 84
10 SASI_Hs02_00369586 predicted 480
11 SASI_Hs01_00181833 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255649 predicted 1166
2 SASI_Rn02_00255650 predicted 574
3 SASI_Rn02_00255651 predicted 437
4 SASI_Rn02_00255652 predicted 1144
5 SASI_Rn02_00255653 predicted 1157
6 SASI_Rn02_00255654 predicted 932
7 SASI_Rn02_00255655 predicted 849
8 SASI_Rn02_00255656 predicted 1068
9 SASI_Rn02_00255657 predicted 823
10 SASI_Rn02_00255658 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064049 predicted 206
2 SASI_Mm01_00064050 predicted 278
3 SASI_Mm01_00064051 predicted 330
4 SASI_Mm01_00064052 predicted 392
5 SASI_Mm01_00064053 predicted 487
6 SASI_Mm01_00064054 predicted 265
7 SASI_Mm01_00064055 predicted 323
8 SASI_Mm01_00064056 predicted 308
9 SASI_Mm02_00330775 predicted 310
10 SASI_Mm01_00064057 predicted 368
11 SASI_Mm01_00064048 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026730
GPIHBP1 MISSION shRNA Bacterial Glycerol Stock
glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026730.1-669s1c1
Sequence:CCGGGCTCAGCTTCTTCACTTGTCTCTCGAGAGACAAGTGAAGAAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026730.1-199s1c1
Sequence:CCGGCCTCTACAATGCTACTTCTGTCTCGAGACAGAAGTAGCATTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-329s1c1
Sequence:CCGGCTACCTACTCCATGTGGTGTACTCGAGTACACCACATGGAGTAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-639s1c1
Sequence:CCGGCTGGACCAAATTTGGTAATATCTCGAGATATTACCAAATTTGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-638s1c1
Sequence:CCGGGCTGGACCAAATTTGGTAATACTCGAGTATTACCAAATTTGGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-120s1c1
Sequence:CCGGGAACTACAACTACGATGATGACTCGAGTCATCATCGTAGTTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026730
GPIHBP1 MISSION shRNA shRNA Plasmid DNA
glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026730.1-669s1c1
Sequence:CCGGGCTCAGCTTCTTCACTTGTCTCTCGAGAGACAAGTGAAGAAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026730.1-199s1c1
Sequence:CCGGCCTCTACAATGCTACTTCTGTCTCGAGACAGAAGTAGCATTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-329s1c1
Sequence:CCGGCTACCTACTCCATGTGGTGTACTCGAGTACACCACATGGAGTAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-639s1c1
Sequence:CCGGCTGGACCAAATTTGGTAATATCTCGAGATATTACCAAATTTGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-638s1c1
Sequence:CCGGGCTGGACCAAATTTGGTAATACTCGAGTATTACCAAATTTGGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-120s1c1
Sequence:CCGGGAACTACAACTACGATGATGACTCGAGTCATCATCGTAGTTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026730
GPIHBP1 MISSION shRNA Lentiviral Transduction Particles
glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026730.1-669s1c1
Sequence:CCGGGCTCAGCTTCTTCACTTGTCTCTCGAGAGACAAGTGAAGAAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026730.1-199s1c1
Sequence:CCGGCCTCTACAATGCTACTTCTGTCTCGAGACAGAAGTAGCATTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-329s1c1
Sequence:CCGGCTACCTACTCCATGTGGTGTACTCGAGTACACCACATGGAGTAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-639s1c1
Sequence:CCGGCTGGACCAAATTTGGTAATATCTCGAGATATTACCAAATTTGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-638s1c1
Sequence:CCGGGCTGGACCAAATTTGGTAATACTCGAGTATTACCAAATTTGGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026730.1-120s1c1
Sequence:CCGGGAACTACAACTACGATGATGACTCGAGTCATCATCGTAGTTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178172
GPIHBP1 MISSION shRNA Bacterial Glycerol Stock
glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166405    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-2082s1c1
Sequence:CCGGCACGTCTTTCTCCTTCTCCTTCTCGAGAAGGAGAAGGAGAAAGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-987s1c1
Sequence:CCGGCCTTAACTTCTGCCATGGGAACTCGAGTTCCCATGGCAGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178172.2-193s1c1
Sequence:CCGGGAGGAAGATGAGGATGAGGTTCTCGAGAACCTCATCCTCATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178172.2-196s1c1
Sequence:CCGGGAAGATGAGGATGAGGTTGAACTCGAGTTCAACCTCATCCTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1493s1c1
Sequence:CCGGGTTGATGAAAGGAGAGGAGTACTCGAGTACTCCTCTCCTTTCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163520    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1506s1c1
Sequence:CCGGGAGGAGTAGATGAGATGGAATCTCGAGATTCCATCTCATCTACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-714s1c1
Sequence:CCGGCCAGCTTTGGAGAATGGATTTCTCGAGAAATCCATTCTCCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1994s1c1
Sequence:CCGGCCGCTAACTGTTCTCTTCTTTCTCGAGAAAGAAGAGAACAGTTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178172.2-181s1c1
Sequence:CCGGGATGACTACGACGAGGAAGATCTCGAGATCTTCCTCGTCGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166140    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1910s1c1
Sequence:CCGGCCACCAGTTCAACACTCCATTCTCGAGAATGGAGTGTTGAACTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1842s1c1
Sequence:CCGGCCACTGACTTGGGTATCAGTTCTCGAGAACTGATACCCAAGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1309s1c1
Sequence:CCGGCCTGGCTTGGAAAGTGAACTTCTCGAGAAGTTCACTTTCCAAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178172
GPIHBP1 MISSION shRNA shRNA Plasmid DNA
glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166405    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-2082s1c1
Sequence:CCGGCACGTCTTTCTCCTTCTCCTTCTCGAGAAGGAGAAGGAGAAAGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-987s1c1
Sequence:CCGGCCTTAACTTCTGCCATGGGAACTCGAGTTCCCATGGCAGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178172.2-193s1c1
Sequence:CCGGGAGGAAGATGAGGATGAGGTTCTCGAGAACCTCATCCTCATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178172.2-196s1c1
Sequence:CCGGGAAGATGAGGATGAGGTTGAACTCGAGTTCAACCTCATCCTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1493s1c1
Sequence:CCGGGTTGATGAAAGGAGAGGAGTACTCGAGTACTCCTCTCCTTTCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163520    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1506s1c1
Sequence:CCGGGAGGAGTAGATGAGATGGAATCTCGAGATTCCATCTCATCTACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-714s1c1
Sequence:CCGGCCAGCTTTGGAGAATGGATTTCTCGAGAAATCCATTCTCCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1994s1c1
Sequence:CCGGCCGCTAACTGTTCTCTTCTTTCTCGAGAAAGAAGAGAACAGTTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178172.2-181s1c1
Sequence:CCGGGATGACTACGACGAGGAAGATCTCGAGATCTTCCTCGTCGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166140    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1910s1c1
Sequence:CCGGCCACCAGTTCAACACTCCATTCTCGAGAATGGAGTGTTGAACTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1842s1c1
Sequence:CCGGCCACTGACTTGGGTATCAGTTCTCGAGAACTGATACCCAAGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1309s1c1
Sequence:CCGGCCTGGCTTGGAAAGTGAACTTCTCGAGAAGTTCACTTTCCAAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178172
GPIHBP1 MISSION shRNA Lentiviral Transduction Particles
glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166405    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-2082s1c1
Sequence:CCGGCACGTCTTTCTCCTTCTCCTTCTCGAGAAGGAGAAGGAGAAAGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-987s1c1
Sequence:CCGGCCTTAACTTCTGCCATGGGAACTCGAGTTCCCATGGCAGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178172.2-193s1c1
Sequence:CCGGGAGGAAGATGAGGATGAGGTTCTCGAGAACCTCATCCTCATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178172.2-196s1c1
Sequence:CCGGGAAGATGAGGATGAGGTTGAACTCGAGTTCAACCTCATCCTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1493s1c1
Sequence:CCGGGTTGATGAAAGGAGAGGAGTACTCGAGTACTCCTCTCCTTTCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163520    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1506s1c1
Sequence:CCGGGAGGAGTAGATGAGATGGAATCTCGAGATTCCATCTCATCTACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-714s1c1
Sequence:CCGGCCAGCTTTGGAGAATGGATTTCTCGAGAAATCCATTCTCCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1994s1c1
Sequence:CCGGCCGCTAACTGTTCTCTTCTTTCTCGAGAAAGAAGAGAACAGTTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178172.2-181s1c1
Sequence:CCGGGATGACTACGACGAGGAAGATCTCGAGATCTTCCTCGTCGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166140    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1910s1c1
Sequence:CCGGCCACCAGTTCAACACTCCATTCTCGAGAATGGAGTGTTGAACTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1842s1c1
Sequence:CCGGCCACTGACTTGGGTATCAGTTCTCGAGAACTGATACCCAAGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178172.2-1309s1c1
Sequence:CCGGCCTGGCTTGGAAAGTGAACTTCTCGAGAAGTTCACTTTCCAAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks