EMAIL THIS PAGE TO A FRIEND

GPKOW

G patch domain and KOW motifs

Synonyms: GPATC5 GPATCH5 Spp2 T54
UniProtKB ID: Q92917, Q59EK5, Q9BQA8
Gene ID:
Human(27238) Summary: This gene encodes a protein with G-patch and KOW domains which are involved in RNA binding. The encoded protein may be orthologous to the Arabidopsis protein, modifier of snc 1, 2, which contains the same domains and is required for innate resistance to some pathogens (PMID: 16271871). [provided by RefSeq, Aug 2011]
Mouse(209416) G patch domain and KOW motifs
Rat(679890) G patch domain and KOW motifs
Zebrafish(368735) G patch domain and KOW motifs
dog(480913) G patch domain and KOW motifs
domestic cat(101100699) G patch domain and KOW motifs
cow(536745) G patch domain and KOW motifs
Horse(100062702) G patch domain and KOW motifs
sheep(101105472) G patch domain and KOW motifs
domestic guinea pig(100719378) G patch domain and KOW motifs
naked mole-rat(101720193) G patch domain and KOW motifs
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015698 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015698 Rosetta Predictions human pricing
NM_001109381 Rosetta Predictions rat pricing
NM_173747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141874 predicted 1285
2 SASI_Hs01_00141875 predicted 1002
3 SASI_Hs01_00141876 predicted 1293
4 SASI_Hs01_00141877 predicted 941
5 SASI_Hs01_00141879 predicted 1136
6 SASI_Hs01_00141880 predicted 319
7 SASI_Hs01_00141881 predicted 1122
8 SASI_Hs01_00141882 predicted 326
9 SASI_Hs01_00141883 predicted 1093
10 SASI_Hs02_00348363 predicted 452
11 SASI_Hs01_00141878 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247856 predicted 288
2 SASI_Rn02_00247857 predicted 1119
3 SASI_Rn02_00247858 predicted 877
4 SASI_Rn02_00247859 predicted 1412
5 SASI_Rn02_00247860 predicted 487
6 SASI_Rn02_00247861 predicted 928
7 SASI_Rn02_00247862 predicted 405
8 SASI_Rn02_00247863 predicted 640
9 SASI_Rn02_00247864 predicted 353
10 SASI_Rn02_00247865 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150505 predicted 876
2 SASI_Mm01_00150506 predicted 1125
3 SASI_Mm01_00150507 predicted 491
4 SASI_Mm01_00150508 predicted 1654
5 SASI_Mm01_00150509 predicted 927
6 SASI_Mm01_00150510 predicted 1640
7 SASI_Mm01_00150511 predicted 1236
8 SASI_Mm01_00150512 predicted 1630
9 SASI_Mm01_00150513 predicted 1428
10 SASI_Mm02_00345390 predicted 413
11 SASI_Mm01_00150504 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173747
VALIDATED
GPKOW MISSION shRNA Bacterial Glycerol Stock
G patch domain and KOW motifs
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-933s1c1
Sequence:CCGGGTGAGCCAAACTTCCACAGAACTCGAGTTCTGTGGAAGTTTGGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-1674s1c1
Sequence:CCGGGCTGAGATAATCAAAGTGGAACTCGAGTTCCACTTTGATTATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-1770s1c1
Sequence:CCGGCCCTTGGAACATGAAATCTATCTCGAGATAGATTTCATGTTCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173747.2-1272s1c1
Sequence:CCGGGATATGCTGGAGACCCTGATTCTCGAGAATCAGGGTCTCCAGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-1172s1c1
Sequence:CCGGCCGCTATTATAACACCAAGATCTCGAGATCTTGGTGTTATAATAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173747.2-1142s1c1
Sequence:CCGGGCGGTTCATTGACAAACTACACTCGAGTGTAGTTTGTCAATGAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173747
VALIDATED
GPKOW MISSION shRNA shRNA Plasmid DNA
G patch domain and KOW motifs
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-933s1c1
Sequence:CCGGGTGAGCCAAACTTCCACAGAACTCGAGTTCTGTGGAAGTTTGGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-1674s1c1
Sequence:CCGGGCTGAGATAATCAAAGTGGAACTCGAGTTCCACTTTGATTATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-1770s1c1
Sequence:CCGGCCCTTGGAACATGAAATCTATCTCGAGATAGATTTCATGTTCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173747.2-1272s1c1
Sequence:CCGGGATATGCTGGAGACCCTGATTCTCGAGAATCAGGGTCTCCAGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-1172s1c1
Sequence:CCGGCCGCTATTATAACACCAAGATCTCGAGATCTTGGTGTTATAATAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173747.2-1142s1c1
Sequence:CCGGGCGGTTCATTGACAAACTACACTCGAGTGTAGTTTGTCAATGAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173747
VALIDATED
GPKOW MISSION shRNA Lentiviral Transduction Particles
G patch domain and KOW motifs
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-933s1c1
Sequence:CCGGGTGAGCCAAACTTCCACAGAACTCGAGTTCTGTGGAAGTTTGGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-1674s1c1
Sequence:CCGGGCTGAGATAATCAAAGTGGAACTCGAGTTCCACTTTGATTATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-1770s1c1
Sequence:CCGGCCCTTGGAACATGAAATCTATCTCGAGATAGATTTCATGTTCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173747.2-1272s1c1
Sequence:CCGGGATATGCTGGAGACCCTGATTCTCGAGAATCAGGGTCTCCAGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173747.2-1172s1c1
Sequence:CCGGCCGCTATTATAACACCAAGATCTCGAGATCTTGGTGTTATAATAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173747.2-1142s1c1
Sequence:CCGGGCGGTTCATTGACAAACTACACTCGAGTGTAGTTTGTCAATGAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015698
VALIDATED
GPKOW MISSION shRNA Bacterial Glycerol Stock
G patch domain and KOW motifs
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015698.3-135s1c1
Sequence:CCGGCGGAGGAGAAGGATTTCTTGACTCGAGTCAAGAAATCCTTCTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015698.3-1128s1c1
Sequence:CCGGGCCAATATTACAACACCAAGACTCGAGTCTTGGTGTTGTAATATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015698.3-1505s1c1
Sequence:CCGGGAAGGTGGGAAGATCATTGTTCTCGAGAACAATGATCTTCCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015698.3-895s1c1
Sequence:CCGGGTTTGACAAGAACACCTTGGACTCGAGTCCAAGGTGTTCTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015698.3-1114s1c1
Sequence:CCGGCATGTACAAAGGAGGCCAATACTCGAGTATTGGCCTCCTTTGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015698.3-692s1c1
Sequence:CCGGGAGCAAGAGAAAGATAAGGAACTCGAGTTCCTTATCTTTCTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015698.3-955s1c1
Sequence:CCGGCCTCTGGAATCAAGAACTCTACTCGAGTAGAGTTCTTGATTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-135s21c1
Sequence:CCGGCGGAGGAGAAGGATTTCTTGACTCGAGTCAAGAAATCCTTCTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-463s21c1
Sequence:CCGGAGTGCCAGAGGAGGCTAATTACTCGAGTAATTAGCCTCCTCTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-1114s21c1
Sequence:CCGGCATGTACAAAGGAGGCCAATACTCGAGTATTGGCCTCCTTTGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015698.3-1498s21c1
Sequence:CCGGGCCTTCAGAAGGTGGGAAGATCTCGAGATCTTCCCACCTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-895s21c1
Sequence:CCGGGTTTGACAAGAACACCTTGGACTCGAGTCCAAGGTGTTCTTGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015698
VALIDATED
GPKOW MISSION shRNA shRNA Plasmid DNA
G patch domain and KOW motifs
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015698.3-135s1c1
Sequence:CCGGCGGAGGAGAAGGATTTCTTGACTCGAGTCAAGAAATCCTTCTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015698.3-1128s1c1
Sequence:CCGGGCCAATATTACAACACCAAGACTCGAGTCTTGGTGTTGTAATATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015698.3-1505s1c1
Sequence:CCGGGAAGGTGGGAAGATCATTGTTCTCGAGAACAATGATCTTCCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015698.3-895s1c1
Sequence:CCGGGTTTGACAAGAACACCTTGGACTCGAGTCCAAGGTGTTCTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015698.3-1114s1c1
Sequence:CCGGCATGTACAAAGGAGGCCAATACTCGAGTATTGGCCTCCTTTGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015698.3-692s1c1
Sequence:CCGGGAGCAAGAGAAAGATAAGGAACTCGAGTTCCTTATCTTTCTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015698.3-955s1c1
Sequence:CCGGCCTCTGGAATCAAGAACTCTACTCGAGTAGAGTTCTTGATTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-135s21c1
Sequence:CCGGCGGAGGAGAAGGATTTCTTGACTCGAGTCAAGAAATCCTTCTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-463s21c1
Sequence:CCGGAGTGCCAGAGGAGGCTAATTACTCGAGTAATTAGCCTCCTCTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-1114s21c1
Sequence:CCGGCATGTACAAAGGAGGCCAATACTCGAGTATTGGCCTCCTTTGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015698.3-1498s21c1
Sequence:CCGGGCCTTCAGAAGGTGGGAAGATCTCGAGATCTTCCCACCTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-895s21c1
Sequence:CCGGGTTTGACAAGAACACCTTGGACTCGAGTCCAAGGTGTTCTTGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015698
VALIDATED
GPKOW MISSION shRNA Lentiviral Transduction Particles
G patch domain and KOW motifs
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015698.3-135s1c1
Sequence:CCGGCGGAGGAGAAGGATTTCTTGACTCGAGTCAAGAAATCCTTCTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015698.3-1128s1c1
Sequence:CCGGGCCAATATTACAACACCAAGACTCGAGTCTTGGTGTTGTAATATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015698.3-1505s1c1
Sequence:CCGGGAAGGTGGGAAGATCATTGTTCTCGAGAACAATGATCTTCCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015698.3-895s1c1
Sequence:CCGGGTTTGACAAGAACACCTTGGACTCGAGTCCAAGGTGTTCTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015698.3-1114s1c1
Sequence:CCGGCATGTACAAAGGAGGCCAATACTCGAGTATTGGCCTCCTTTGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015698.3-692s1c1
Sequence:CCGGGAGCAAGAGAAAGATAAGGAACTCGAGTTCCTTATCTTTCTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015698.3-955s1c1
Sequence:CCGGCCTCTGGAATCAAGAACTCTACTCGAGTAGAGTTCTTGATTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-135s21c1
Sequence:CCGGCGGAGGAGAAGGATTTCTTGACTCGAGTCAAGAAATCCTTCTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-463s21c1
Sequence:CCGGAGTGCCAGAGGAGGCTAATTACTCGAGTAATTAGCCTCCTCTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-1114s21c1
Sequence:CCGGCATGTACAAAGGAGGCCAATACTCGAGTATTGGCCTCCTTTGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015698.3-1498s21c1
Sequence:CCGGGCCTTCAGAAGGTGGGAAGATCTCGAGATCTTCCCACCTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015698.3-895s21c1
Sequence:CCGGGTTTGACAAGAACACCTTGGACTCGAGTCCAAGGTGTTCTTGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks