EMAIL THIS PAGE TO A FRIEND

GPLD1

glycosylphosphatidylinositol specific phospholipase D1

68 Gene Product Result for
Synonyms: GPIPLD GPIPLDM PIGPLD PIGPLD1
Gene ID:
Human(2822) Summary: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]
Mouse(14756) glycosylphosphatidylinositol specific phospholipase D1
Rat(291132) glycosylphosphatidylinositol specific phospholipase D1
domestic guinea pig(100734898) glycosylphosphatidylinositol specific phospholipase D1
naked mole-rat(101724062) glycosylphosphatidylinositol specific phospholipase D1
sheep(101119000) glycosylphosphatidylinositol specific phospholipase D1
chicken(420819) glycosylphosphatidylinositol specific phospholipase D1
cow(287025) glycosylphosphatidylinositol specific phospholipase D1
Horse(100067517) glycosylphosphatidylinositol specific phospholipase D1
domestic cat(101088486) glycosylphosphatidylinositol specific phospholipase D1
dog(478735) glycosylphosphatidylinositol specific phospholipase D1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001503 Rosetta Predictions human pricing
NM_177483 Rosetta Predictions human pricing
XM_001070303 Rosetta Predictions rat pricing
XM_214480 Rosetta Predictions rat pricing
NM_008156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237116 predicted 292
2 SASI_Hs01_00237117 predicted 372
3 SASI_Hs01_00237118 predicted 364
4 SASI_Hs01_00237119 predicted 286
5 SASI_Hs01_00237120 predicted 300
6 SASI_Hs01_00237121 predicted 362
7 SASI_Hs01_00237122 predicted 370
8 SASI_Hs01_00237123 predicted 370
9 SASI_Hs01_00237124 predicted 277
10 SASI_Hs01_00237125 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069552 predicted 244
2 SASI_Hs01_00069553 predicted 324
3 SASI_Hs01_00069554 predicted 314
4 SASI_Hs01_00069555 predicted 235
5 SASI_Hs01_00069556 predicted 241
6 SASI_Hs01_00069557 predicted 307
7 SASI_Hs01_00069558 predicted 319
8 SASI_Hs01_00069559 predicted 319
9 SASI_Hs01_00069560 predicted 229
10 SASI_Hs01_00069561 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331168 predicted 1444
2 SASI_Rn02_00331169 predicted 293
3 SASI_Rn02_00331170 predicted 759
4 SASI_Rn02_00331171 predicted 1970
5 SASI_Rn02_00331172 predicted 1678
6 SASI_Rn02_00331173 predicted 1466
7 SASI_Rn02_00331174 predicted 2387
8 SASI_Rn02_00331175 predicted 684
9 SASI_Rn02_00331176 predicted 2525
10 SASI_Rn02_00331177 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375335 predicted 1446
2 SASI_Rn02_00375336 predicted 289
3 SASI_Rn02_00375337 predicted 758
4 SASI_Rn02_00375338 predicted 1965
5 SASI_Rn02_00375339 predicted 1685
6 SASI_Rn02_00375340 predicted 1464
7 SASI_Rn02_00375341 predicted 2389
8 SASI_Rn02_00375342 predicted 686
9 SASI_Rn02_00375343 predicted 2528
10 SASI_Rn02_00375344 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195223 predicted 1759
2 SASI_Mm01_00195224 predicted 994
3 SASI_Mm01_00195226 predicted 2832
4 SASI_Mm01_00195227 predicted 389
5 SASI_Mm01_00195228 predicted 1745
6 SASI_Mm02_00313258 predicted 456
7 SASI_Mm01_00195229 predicted 900
8 SASI_Mm01_00195230 predicted 2214
9 SASI_Mm02_00313259 predicted 875
10 SASI_Mm02_00313260 predicted 2436
11 SASI_Mm01_00195222 predicted 963
12 SASI_Mm01_00195225 predicted 867
13 SASI_Mm01_00195231 predicted 663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001503
GPLD1 MISSION shRNA Bacterial Glycerol Stock
glycosylphosphatidylinositol specific phospholipase D1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001503.2-777s21c1
Sequence:CCGGGCTAGCTGTTTCCAAGTTATACTCGAGTATAACTTGGAAACAGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001503.2-2890s21c1
Sequence:CCGGCTCGCTCCCTTTGCATCTAAACTCGAGTTTAGATGCAAAGGGAGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001503.2-2125s21c1
Sequence:CCGGACGTACGATGACGTGTCTAAGCTCGAGCTTAGACACGTCATCGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001503.2-566s1c1
Sequence:CCGGGCTCCTATTCAGAGGCTCATTCTCGAGAATGAGCCTCTGAATAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001503.2-1932s1c1
Sequence:CCGGGCTGGGCCATTTGTTACACATCTCGAGATGTGTAACAAATGGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001503.2-2376s1c1
Sequence:CCGGCGGCCGAGTATATGTATATAACTCGAGTTATATACATATACTCGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001503
GPLD1 MISSION shRNA shRNA Plasmid DNA
glycosylphosphatidylinositol specific phospholipase D1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001503.2-777s21c1
Sequence:CCGGGCTAGCTGTTTCCAAGTTATACTCGAGTATAACTTGGAAACAGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001503.2-2890s21c1
Sequence:CCGGCTCGCTCCCTTTGCATCTAAACTCGAGTTTAGATGCAAAGGGAGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001503.2-2125s21c1
Sequence:CCGGACGTACGATGACGTGTCTAAGCTCGAGCTTAGACACGTCATCGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001503.2-566s1c1
Sequence:CCGGGCTCCTATTCAGAGGCTCATTCTCGAGAATGAGCCTCTGAATAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001503.2-1932s1c1
Sequence:CCGGGCTGGGCCATTTGTTACACATCTCGAGATGTGTAACAAATGGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001503.2-2376s1c1
Sequence:CCGGCGGCCGAGTATATGTATATAACTCGAGTTATATACATATACTCGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001503
GPLD1 MISSION shRNA Lentiviral Transduction Particles
glycosylphosphatidylinositol specific phospholipase D1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001503.2-777s21c1
Sequence:CCGGGCTAGCTGTTTCCAAGTTATACTCGAGTATAACTTGGAAACAGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001503.2-2890s21c1
Sequence:CCGGCTCGCTCCCTTTGCATCTAAACTCGAGTTTAGATGCAAAGGGAGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001503.2-2125s21c1
Sequence:CCGGACGTACGATGACGTGTCTAAGCTCGAGCTTAGACACGTCATCGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001503.2-566s1c1
Sequence:CCGGGCTCCTATTCAGAGGCTCATTCTCGAGAATGAGCCTCTGAATAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001503.2-1932s1c1
Sequence:CCGGGCTGGGCCATTTGTTACACATCTCGAGATGTGTAACAAATGGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001503.2-2376s1c1
Sequence:CCGGCGGCCGAGTATATGTATATAACTCGAGTTATATACATATACTCGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008156
GPLD1 MISSION shRNA Bacterial Glycerol Stock
glycosylphosphatidylinositol specific phospholipase D1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008156.1-1266s1c1
Sequence:CCGGGCCGGAATCTGTCACCTTTATCTCGAGATAAAGGTGACAGATTCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008156.1-2437s1c1
Sequence:CCGGGACCTGGATGATGATGGCTTACTCGAGTAAGCCATCATCATCCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008156.1-3115s1c1
Sequence:CCGGGCTGGTCCTATTTGGATCTTACTCGAGTAAGATCCAAATAGGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008156.1-1031s1c1
Sequence:CCGGCCACGAACATTTACCGTTTGACTCGAGTCAAACGGTAAATGTTCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008156
GPLD1 MISSION shRNA shRNA Plasmid DNA
glycosylphosphatidylinositol specific phospholipase D1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008156.1-1266s1c1
Sequence:CCGGGCCGGAATCTGTCACCTTTATCTCGAGATAAAGGTGACAGATTCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008156.1-2437s1c1
Sequence:CCGGGACCTGGATGATGATGGCTTACTCGAGTAAGCCATCATCATCCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008156.1-3115s1c1
Sequence:CCGGGCTGGTCCTATTTGGATCTTACTCGAGTAAGATCCAAATAGGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008156.1-1031s1c1
Sequence:CCGGCCACGAACATTTACCGTTTGACTCGAGTCAAACGGTAAATGTTCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008156
GPLD1 MISSION shRNA Lentiviral Transduction Particles
glycosylphosphatidylinositol specific phospholipase D1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008156.1-1266s1c1
Sequence:CCGGGCCGGAATCTGTCACCTTTATCTCGAGATAAAGGTGACAGATTCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008156.1-2437s1c1
Sequence:CCGGGACCTGGATGATGATGGCTTACTCGAGTAAGCCATCATCATCCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008156.1-3115s1c1
Sequence:CCGGGCTGGTCCTATTTGGATCTTACTCGAGTAAGATCCAAATAGGACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008156.1-1031s1c1
Sequence:CCGGCCACGAACATTTACCGTTTGACTCGAGTCAAACGGTAAATGTTCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)