EMAIL THIS PAGE TO A FRIEND

GPM6A

glycoprotein M6A

198 Gene Product Result for
Synonyms: GPM6 M6A
UniProtKB ID: P51674, B7Z642, E9PHI5, Q92602
Gene ID:
Mouse(234267) glycoprotein m6a
Rat(306439) glycoprotein m6a
chicken(422569) glycoprotein M6A
dog(475641) glycoprotein M6A
domestic cat(101080277) glycoprotein M6A
cow(507389) glycoprotein M6A
sheep(101106904) glycoprotein M6A
naked mole-rat(101716059) glycoprotein M6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005277 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086201 MISSION® esiRNA esiRNA human GPM6A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005277 Rosetta Predictions human pricing
NM_201591 Rosetta Predictions human pricing
NM_201592 Rosetta Predictions human pricing
NM_178105 Rosetta Predictions rat pricing
NM_153581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153706 predicted 890
2 SASI_Hs01_00153707 predicted 463
3 SASI_Hs01_00153708 predicted 714
4 SASI_Hs02_00339329 predicted 741
5 SASI_Hs01_00153709 predicted 1025
6 SASI_Hs01_00153710 predicted 1035
7 SASI_Hs01_00153711 predicted 976
8 SASI_Hs01_00153713 predicted 732
9 SASI_Hs01_00153714 predicted 506
10 SASI_Hs01_00153715 predicted 597
11 SASI_Hs01_00153712 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211961 predicted 1481
2 SASI_Hs01_00211962 predicted 1059
3 SASI_Hs01_00211963 predicted 1303
4 SASI_Hs02_00373093 predicted 1330
5 SASI_Hs01_00211964 predicted 1616
6 SASI_Hs01_00211965 predicted 1633
7 SASI_Hs01_00211966 predicted 1565
8 SASI_Hs01_00211968 predicted 1325
9 SASI_Hs01_00211969 predicted 1095
10 SASI_Hs01_00211970 predicted 1183
11 SASI_Hs01_00211967 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140911 predicted 834
2 SASI_Hs01_00140912 predicted 408
3 SASI_Hs01_00140913 predicted 659
4 SASI_Hs02_00373094 predicted 682
5 SASI_Hs01_00140914 predicted 966
6 SASI_Hs01_00140915 predicted 973
7 SASI_Hs01_00140916 predicted 910
8 SASI_Hs01_00140918 predicted 668
9 SASI_Hs01_00140919 predicted 451
10 SASI_Hs01_00140920 predicted 534
11 SASI_Hs01_00140917 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050196 predicted 243
2 SASI_Rn01_00050197 predicted 406
3 SASI_Rn01_00050198 predicted 872
4 SASI_Rn01_00050199 predicted 848
5 SASI_Rn02_00269635 predicted 554
6 SASI_Rn01_00050201 predicted 839
7 SASI_Rn01_00050202 predicted 762
8 SASI_Rn01_00050203 predicted 805
9 SASI_Rn01_00050204 predicted 940
10 SASI_Rn01_00050205 predicted 526
11 SASI_Rn01_00050200 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045234 predicted 924
2 SASI_Mm01_00045235 predicted 817
3 SASI_Mm01_00045236 predicted 1104
4 SASI_Mm01_00045237 predicted 938
5 SASI_Mm01_00045238 predicted 662
6 SASI_Mm01_00045239 predicted 1255
7 SASI_Mm01_00045240 predicted 1046
8 SASI_Mm02_00343389 predicted 765
9 SASI_Mm01_00045241 predicted 512
10 SASI_Mm01_00045242 predicted 1178
11 SASI_Mm01_00045243 predicted 1234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153581
VALIDATED
GPM6A MISSION shRNA Bacterial Glycerol Stock
glycoprotein M6A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153581.2-1585s1c1
Sequence:CCGGCCTCCCACATATCACACATAACTCGAGTTATGTGTGATATGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153581.2-1040s1c1
Sequence:CCGGGTGTGAATCTACTGAGCTGAACTCGAGTTCAGCTCAGTAGATTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153581.2-888s1c1
Sequence:CCGGCCCGTGTACATGTATTTCAATCTCGAGATTGAAATACATGTACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153581.2-587s1c1
Sequence:CCGGCCTTTCTGGAACAGTCAACATCTCGAGATGTTGACTGTTCCAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153581.2-833s1c1
Sequence:CCGGGCTGACATACCTCTTCATGTTCTCGAGAACATGAAGAGGTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153581.4-1543s21c1
Sequence:CCGGTTAACATTGTCCAACGCAAATCTCGAGATTTGCGTTGGACAATGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153581.4-477s21c1
Sequence:CCGGGCTTCGAGTGCTGCATTAAATCTCGAGATTTAATGCAGCACTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153581.4-1747s21c1
Sequence:CCGGCATGATGACTCCGCTTGATATCTCGAGATATCAAGCGGAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153581.4-1255s21c1
Sequence:CCGGGCTCAATGCGTACACATAAATCTCGAGATTTATGTGTACGCATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153581
VALIDATED
GPM6A MISSION shRNA shRNA Plasmid DNA
glycoprotein M6A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153581.2-1585s1c1
Sequence:CCGGCCTCCCACATATCACACATAACTCGAGTTATGTGTGATATGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153581.2-1040s1c1
Sequence:CCGGGTGTGAATCTACTGAGCTGAACTCGAGTTCAGCTCAGTAGATTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153581.2-888s1c1
Sequence:CCGGCCCGTGTACATGTATTTCAATCTCGAGATTGAAATACATGTACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153581.2-587s1c1
Sequence:CCGGCCTTTCTGGAACAGTCAACATCTCGAGATGTTGACTGTTCCAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153581.2-833s1c1
Sequence:CCGGGCTGACATACCTCTTCATGTTCTCGAGAACATGAAGAGGTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153581.4-1543s21c1
Sequence:CCGGTTAACATTGTCCAACGCAAATCTCGAGATTTGCGTTGGACAATGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153581.4-477s21c1
Sequence:CCGGGCTTCGAGTGCTGCATTAAATCTCGAGATTTAATGCAGCACTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153581.4-1747s21c1
Sequence:CCGGCATGATGACTCCGCTTGATATCTCGAGATATCAAGCGGAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153581.4-1255s21c1
Sequence:CCGGGCTCAATGCGTACACATAAATCTCGAGATTTATGTGTACGCATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153581
VALIDATED
GPM6A MISSION shRNA Lentiviral Transduction Particles
glycoprotein M6A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153581.2-1585s1c1
Sequence:CCGGCCTCCCACATATCACACATAACTCGAGTTATGTGTGATATGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153581.2-1040s1c1
Sequence:CCGGGTGTGAATCTACTGAGCTGAACTCGAGTTCAGCTCAGTAGATTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153581.2-888s1c1
Sequence:CCGGCCCGTGTACATGTATTTCAATCTCGAGATTGAAATACATGTACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153581.2-587s1c1
Sequence:CCGGCCTTTCTGGAACAGTCAACATCTCGAGATGTTGACTGTTCCAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153581.2-833s1c1
Sequence:CCGGGCTGACATACCTCTTCATGTTCTCGAGAACATGAAGAGGTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153581.4-1543s21c1
Sequence:CCGGTTAACATTGTCCAACGCAAATCTCGAGATTTGCGTTGGACAATGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153581.4-477s21c1
Sequence:CCGGGCTTCGAGTGCTGCATTAAATCTCGAGATTTAATGCAGCACTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153581.4-1747s21c1
Sequence:CCGGCATGATGACTCCGCTTGATATCTCGAGATATCAAGCGGAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153581.4-1255s21c1
Sequence:CCGGGCTCAATGCGTACACATAAATCTCGAGATTTATGTGTACGCATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005277
GPM6A MISSION shRNA Bacterial Glycerol Stock
glycoprotein M6A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005277.3-1709s1c1
Sequence:CCGGCCCTCAGATTACTCATGTTTACTCGAGTAAACATGAGTAATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-482s1c1
Sequence:CCGGGCGTTCTTTGTGTATGGCATTCTCGAGAATGCCATACACAAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-661s1c1
Sequence:CCGGGCCAGTTTACATGTACTTCAACTCGAGTTGAAGTACATGTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-878s1c1
Sequence:CCGGGCAGCAGTCATTGCTATGGTTCTCGAGAACCATAGCAATGACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-662s1c1
Sequence:CCGGCCAGTTTACATGTACTTCAATCTCGAGATTGAAGTACATGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005277.3-662s21c1
Sequence:CCGGCCAGTTTACATGTACTTCAATCTCGAGATTGAAGTACATGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005277.3-1709s21c1
Sequence:CCGGCCCTCAGATTACTCATGTTTACTCGAGTAAACATGAGTAATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005277.3-878s21c1
Sequence:CCGGGCAGCAGTCATTGCTATGGTTCTCGAGAACCATAGCAATGACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005277.3-482s21c1
Sequence:CCGGGCGTTCTTTGTGTATGGCATTCTCGAGAATGCCATACACAAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005277
GPM6A MISSION shRNA shRNA Plasmid DNA
glycoprotein M6A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005277.3-1709s1c1
Sequence:CCGGCCCTCAGATTACTCATGTTTACTCGAGTAAACATGAGTAATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-482s1c1
Sequence:CCGGGCGTTCTTTGTGTATGGCATTCTCGAGAATGCCATACACAAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-661s1c1
Sequence:CCGGGCCAGTTTACATGTACTTCAACTCGAGTTGAAGTACATGTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-878s1c1
Sequence:CCGGGCAGCAGTCATTGCTATGGTTCTCGAGAACCATAGCAATGACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-662s1c1
Sequence:CCGGCCAGTTTACATGTACTTCAATCTCGAGATTGAAGTACATGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005277.3-662s21c1
Sequence:CCGGCCAGTTTACATGTACTTCAATCTCGAGATTGAAGTACATGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005277.3-1709s21c1
Sequence:CCGGCCCTCAGATTACTCATGTTTACTCGAGTAAACATGAGTAATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005277.3-878s21c1
Sequence:CCGGGCAGCAGTCATTGCTATGGTTCTCGAGAACCATAGCAATGACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005277.3-482s21c1
Sequence:CCGGGCGTTCTTTGTGTATGGCATTCTCGAGAATGCCATACACAAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005277
GPM6A MISSION shRNA Lentiviral Transduction Particles
glycoprotein M6A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005277.3-1709s1c1
Sequence:CCGGCCCTCAGATTACTCATGTTTACTCGAGTAAACATGAGTAATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-482s1c1
Sequence:CCGGGCGTTCTTTGTGTATGGCATTCTCGAGAATGCCATACACAAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-661s1c1
Sequence:CCGGGCCAGTTTACATGTACTTCAACTCGAGTTGAAGTACATGTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-878s1c1
Sequence:CCGGGCAGCAGTCATTGCTATGGTTCTCGAGAACCATAGCAATGACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005277.3-662s1c1
Sequence:CCGGCCAGTTTACATGTACTTCAATCTCGAGATTGAAGTACATGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005277.3-662s21c1
Sequence:CCGGCCAGTTTACATGTACTTCAATCTCGAGATTGAAGTACATGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005277.3-1709s21c1
Sequence:CCGGCCCTCAGATTACTCATGTTTACTCGAGTAAACATGAGTAATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005277.3-878s21c1
Sequence:CCGGGCAGCAGTCATTGCTATGGTTCTCGAGAACCATAGCAATGACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005277.3-482s21c1
Sequence:CCGGGCGTTCTTTGTGTATGGCATTCTCGAGAATGCCATACACAAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks