EMAIL THIS PAGE TO A FRIEND

GPM6B

glycoprotein M6B

Synonyms: M6B
UniProtKB ID: Q13491, O76077, Q86X43, Q8N956
Gene ID:
Human(2824) Summary: This gene encodes a membrane glycoprotein that belongs to the proteolipid protein family. Proteolipid protein family members are expressed in most brain regions and are thought to be involved in cellular housekeeping functions, such as membrane trafficking and cell-to-cell communication. [provided by RefSeq, Apr 2009]
Mouse(14758) glycoprotein m6b
Rat(192179) glycoprotein m6b
chicken(418632) glycoprotein M6B
cow(516689) glycoprotein M6B
Horse(100050640) glycoprotein M6B
domestic cat(101089746) glycoprotein M6B
dog(480842) glycoprotein M6B
naked mole-rat(101719255) glycoprotein M6B
sheep(101120549) glycoprotein M6B
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001994 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080101 MISSION® esiRNA esiRNA human GPM6B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001994 Rosetta Predictions human pricing
NM_001001995 Rosetta Predictions human pricing
NM_001001996 Rosetta Predictions human pricing
NM_005278 Rosetta Predictions human pricing
NM_138846 Rosetta Predictions rat pricing
NM_023122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183350 predicted 515
2 SASI_Hs01_00183351 predicted 442
3 SASI_Hs01_00183352 predicted 408
4 SASI_Hs01_00183353 predicted 521
5 SASI_Hs01_00183354 predicted 604
6 SASI_Hs02_00304061 predicted 519
7 SASI_Hs01_00183355 predicted 529
8 SASI_Hs01_00183356 predicted 627
9 SASI_Hs01_00183357 predicted 606
10 SASI_Hs01_00183358 predicted 610
11 SASI_Hs01_00183359 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037289 predicted 780
2 SASI_Hs01_00037290 predicted 709
3 SASI_Hs01_00037291 predicted 681
4 SASI_Hs01_00037292 predicted 784
5 SASI_Hs01_00037293 predicted 862
6 SASI_Hs02_00304062 predicted 788
7 SASI_Hs01_00037294 predicted 791
8 SASI_Hs01_00037295 predicted 896
9 SASI_Hs01_00037296 predicted 874
10 SASI_Hs01_00037297 predicted 879
11 SASI_Hs01_00037298 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210713 predicted 783
2 SASI_Hs01_00210714 predicted 709
3 SASI_Hs01_00210715 predicted 676
4 SASI_Hs01_00210716 predicted 781
5 SASI_Hs01_00210717 predicted 862
6 SASI_Hs02_00304063 predicted 785
7 SASI_Hs01_00210718 predicted 796
8 SASI_Hs01_00210719 predicted 895
9 SASI_Hs01_00210720 predicted 873
10 SASI_Hs01_00210721 predicted 870
11 SASI_Hs01_00210722 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202247 predicted 665
2 SASI_Hs01_00202248 predicted 593
3 SASI_Hs01_00202249 predicted 556
4 SASI_Hs01_00202250 predicted 664
5 SASI_Hs01_00202251 predicted 749
6 SASI_Hs02_00339330 predicted 661
7 SASI_Hs01_00202252 predicted 669
8 SASI_Hs01_00202253 predicted 774
9 SASI_Hs01_00202254 predicted 751
10 SASI_Hs01_00202255 predicted 755
11 SASI_Hs01_00202256 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064882 predicted 257
2 SASI_Rn01_00064883 predicted 1040
3 SASI_Rn01_00064884 predicted 903
4 SASI_Rn01_00064885 predicted 1024
5 SASI_Rn01_00064886 predicted 494
6 SASI_Rn01_00064887 predicted 363
7 SASI_Rn01_00064888 predicted 942
8 SASI_Rn01_00064889 predicted 865
9 SASI_Rn01_00064890 predicted 430
10 SASI_Rn01_00064891 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034038 predicted 353
2 SASI_Mm01_00034040 predicted 840
3 SASI_Mm01_00034041 predicted 403
4 SASI_Mm01_00034042 predicted 765
5 SASI_Mm01_00034043 predicted 944
6 SASI_Mm02_00326815 predicted 1009
7 SASI_Mm01_00034044 predicted 727
8 SASI_Mm01_00034045 predicted 838
9 SASI_Mm01_00034046 predicted 291
10 SASI_Mm01_00034047 predicted 921
11 SASI_Mm01_00034039 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023122
GPM6B MISSION shRNA Bacterial Glycerol Stock
glycoprotein M6B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023122.2-1233s21c1
Sequence:CCGGAGTCGTGGCATGTCCAGTTAACTCGAGTTAACTGGACATGCCACGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023122.2-1329s21c1
Sequence:CCGGAGGATATGACCCTAGATTTACCTCGAGGTAAATCTAGGGTCATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023122.2-951s21c1
Sequence:CCGGCAACTCAATTCTTACACTTAACTCGAGTTAAGTGTAAGAATTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023122.1-1995s1c1
Sequence:CCGGCCCGGAATATAATGTTTGATACTCGAGTATCAAACATTATATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-572s1c1
Sequence:CCGGGCCAGTGTTTATGTTCTACAACTCGAGTTGTAGAACATAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-842s1c1
Sequence:CCGGGTCTTCTAACTGGGCTTACTTCTCGAGAAGTAAGCCCAGTTAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-737s1c1
Sequence:CCGGCATCTGCAACACGAATGAGTTCTCGAGAACTCATTCGTGTTGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-351s1c1
Sequence:CCGGGTGATCCAACTGATGCAGTATCTCGAGATACTGCATCAGTTGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023122
GPM6B MISSION shRNA shRNA Plasmid DNA
glycoprotein M6B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023122.2-1233s21c1
Sequence:CCGGAGTCGTGGCATGTCCAGTTAACTCGAGTTAACTGGACATGCCACGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023122.2-1329s21c1
Sequence:CCGGAGGATATGACCCTAGATTTACCTCGAGGTAAATCTAGGGTCATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023122.2-951s21c1
Sequence:CCGGCAACTCAATTCTTACACTTAACTCGAGTTAAGTGTAAGAATTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023122.1-1995s1c1
Sequence:CCGGCCCGGAATATAATGTTTGATACTCGAGTATCAAACATTATATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-572s1c1
Sequence:CCGGGCCAGTGTTTATGTTCTACAACTCGAGTTGTAGAACATAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-842s1c1
Sequence:CCGGGTCTTCTAACTGGGCTTACTTCTCGAGAAGTAAGCCCAGTTAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-737s1c1
Sequence:CCGGCATCTGCAACACGAATGAGTTCTCGAGAACTCATTCGTGTTGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-351s1c1
Sequence:CCGGGTGATCCAACTGATGCAGTATCTCGAGATACTGCATCAGTTGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023122
GPM6B MISSION shRNA Lentiviral Transduction Particles
glycoprotein M6B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023122.2-1233s21c1
Sequence:CCGGAGTCGTGGCATGTCCAGTTAACTCGAGTTAACTGGACATGCCACGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023122.2-1329s21c1
Sequence:CCGGAGGATATGACCCTAGATTTACCTCGAGGTAAATCTAGGGTCATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023122.2-951s21c1
Sequence:CCGGCAACTCAATTCTTACACTTAACTCGAGTTAAGTGTAAGAATTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023122.1-1995s1c1
Sequence:CCGGCCCGGAATATAATGTTTGATACTCGAGTATCAAACATTATATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-572s1c1
Sequence:CCGGGCCAGTGTTTATGTTCTACAACTCGAGTTGTAGAACATAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-842s1c1
Sequence:CCGGGTCTTCTAACTGGGCTTACTTCTCGAGAAGTAAGCCCAGTTAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-737s1c1
Sequence:CCGGCATCTGCAACACGAATGAGTTCTCGAGAACTCATTCGTGTTGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023122.1-351s1c1
Sequence:CCGGGTGATCCAACTGATGCAGTATCTCGAGATACTGCATCAGTTGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001994
GPM6B MISSION shRNA Bacterial Glycerol Stock
glycoprotein M6B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001994.1-1121s21c1
Sequence:CCGGATGAGATCTGGTGGCTATTTCCTCGAGGAAATAGCCACCAGATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001994.1-711s21c1
Sequence:CCGGTCCGACAATACGGTATCATTCCTCGAGGAATGATACCGTATTGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001994.1-1217s21c1
Sequence:CCGGCATTAGAGAGCAGTATCTTTACTCGAGTAAAGATACTGCTCTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001994.1-1010s1c1
Sequence:CCGGGCAGAGTCTAGGTTTCTGCAACTCGAGTTGCAGAAACCTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-917s1c1
Sequence:CCGGCGGGAAGATTGCTGCACTAAACTCGAGTTTAGTGCAGCAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-532s1c1
Sequence:CCGGCCGATGCATCAGTGGAATGTTCTCGAGAACATTCCACTGATGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-392s1c1
Sequence:CCGGGTGATACAACTGATGCAGTATCTCGAGATACTGCATCAGTTGTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-613s1c1
Sequence:CCGGGCCCGTGTTTATGTTCTACAACTCGAGTTGTAGAACATAAACACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001994
GPM6B MISSION shRNA shRNA Plasmid DNA
glycoprotein M6B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001994.1-1121s21c1
Sequence:CCGGATGAGATCTGGTGGCTATTTCCTCGAGGAAATAGCCACCAGATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001994.1-711s21c1
Sequence:CCGGTCCGACAATACGGTATCATTCCTCGAGGAATGATACCGTATTGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001994.1-1217s21c1
Sequence:CCGGCATTAGAGAGCAGTATCTTTACTCGAGTAAAGATACTGCTCTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001994.1-1010s1c1
Sequence:CCGGGCAGAGTCTAGGTTTCTGCAACTCGAGTTGCAGAAACCTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-917s1c1
Sequence:CCGGCGGGAAGATTGCTGCACTAAACTCGAGTTTAGTGCAGCAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-532s1c1
Sequence:CCGGCCGATGCATCAGTGGAATGTTCTCGAGAACATTCCACTGATGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-392s1c1
Sequence:CCGGGTGATACAACTGATGCAGTATCTCGAGATACTGCATCAGTTGTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-613s1c1
Sequence:CCGGGCCCGTGTTTATGTTCTACAACTCGAGTTGTAGAACATAAACACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001994
GPM6B MISSION shRNA Lentiviral Transduction Particles
glycoprotein M6B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001994.1-1121s21c1
Sequence:CCGGATGAGATCTGGTGGCTATTTCCTCGAGGAAATAGCCACCAGATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001994.1-711s21c1
Sequence:CCGGTCCGACAATACGGTATCATTCCTCGAGGAATGATACCGTATTGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001994.1-1217s21c1
Sequence:CCGGCATTAGAGAGCAGTATCTTTACTCGAGTAAAGATACTGCTCTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001994.1-1010s1c1
Sequence:CCGGGCAGAGTCTAGGTTTCTGCAACTCGAGTTGCAGAAACCTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-917s1c1
Sequence:CCGGCGGGAAGATTGCTGCACTAAACTCGAGTTTAGTGCAGCAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-532s1c1
Sequence:CCGGCCGATGCATCAGTGGAATGTTCTCGAGAACATTCCACTGATGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-392s1c1
Sequence:CCGGGTGATACAACTGATGCAGTATCTCGAGATACTGCATCAGTTGTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001994.1-613s1c1
Sequence:CCGGGCCCGTGTTTATGTTCTACAACTCGAGTTGTAGAACATAAACACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks