EMAIL THIS PAGE TO A FRIEND

GPN1

GPN-loop GTPase 1

55 Gene Product Result for
Synonyms: ATPBD1A MBDIN NTPBP RPAP4 XAB1
UniProtKB ID: Q9HCN4, B4DQJ5, B4DXU4, B5MBZ5, O76004
Gene ID:
Human(11321) Summary: This gene encodes a guanosine triphosphatase enzyme. The encoded protein may play a role in DNA repair and may function in activation of transcription. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Mouse(74254) GPN-loop GTPase 1
Rat(688393) GPN-loop GTPase 1
cow(508522) GPN-loop GTPase 1
domestic cat(101095248) GPN-loop GTPase 1
sheep(101119805) GPN-loop GTPase 1
domestic guinea pig(100729379) GPN-loop GTPase 1
naked mole-rat(101722370) GPN-loop GTPase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007266 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007266 Rosetta Predictions human pricing
NM_001127572 Rosetta Predictions rat pricing
NM_133756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023553 predicted 1145
2 SASI_Hs01_00023554 predicted 690
3 SASI_Hs01_00023555 predicted 674
4 SASI_Hs01_00023556 predicted 218
5 SASI_Hs01_00023558 predicted 226
6 SASI_Hs01_00023559 predicted 529
7 SASI_Hs01_00023560 predicted 823
8 SASI_Hs01_00023561 predicted 482
9 SASI_Hs01_00023562 predicted 661
10 SASI_Hs02_00343301 predicted 1151
11 SASI_Hs01_00023557 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254473 predicted 812
2 SASI_Rn02_00254474 predicted 313
3 SASI_Rn02_00254475 predicted 825
4 SASI_Rn02_00254476 predicted 814
5 SASI_Rn02_00254477 predicted 504
6 SASI_Rn02_00254478 predicted 1088
7 SASI_Rn02_00254479 predicted 828
8 SASI_Rn02_00254480 predicted 1039
9 SASI_Rn02_00254481 predicted 328
10 SASI_Rn02_00254482 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063175 predicted 1076
2 SASI_Mm01_00063176 predicted 807
3 SASI_Mm01_00063177 predicted 1095
4 SASI_Mm01_00063178 predicted 504
5 SASI_Mm01_00063179 predicted 656
6 SASI_Mm01_00063180 predicted 816
7 SASI_Mm01_00063181 predicted 321
8 SASI_Mm01_00063182 predicted 1076
9 SASI_Mm01_00063183 predicted 655
10 SASI_Mm01_00063184 predicted 462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007266
VALIDATED
GPN1 MISSION shRNA Bacterial Glycerol Stock
GPN-loop GTPase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007266.1-835s1c1
Sequence:CCGGCCTGAATATGAACGTCTGAAACTCGAGTTTCAGACGTTCATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-196s1c1
Sequence:CCGGGCAGTACATGAAGTTCCCTTTCTCGAGAAAGGGAACTTCATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-358s1c1
Sequence:CCGGGCCCAGAACATGTCCAAATATCTCGAGATATTTGGACATGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-220s1c1
Sequence:CCGGGCCAATATTGATATTCGTGATCTCGAGATCACGAATATCAATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-659s1c1
Sequence:CCGGCCTTGAATCAAGAGACTACATCTCGAGATGTAGTCTCTTGATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-397s21c1
Sequence:CCGGGCCCAGAACATGTCCAAATATCTCGAGATATTTGGACATGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-235s21c1
Sequence:CCGGGCAGTACATGAAGTTCCCTTTCTCGAGAAAGGGAACTTCATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-259s21c1
Sequence:CCGGGCCAATATTGATATTCGTGATCTCGAGATCACGAATATCAATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-874s21c1
Sequence:CCGGCCTGAATATGAACGTCTGAAACTCGAGTTTCAGACGTTCATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-698s21c1
Sequence:CCGGCCTTGAATCAAGAGACTACATCTCGAGATGTAGTCTCTTGATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007266
VALIDATED
GPN1 MISSION shRNA shRNA Plasmid DNA
GPN-loop GTPase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007266.1-835s1c1
Sequence:CCGGCCTGAATATGAACGTCTGAAACTCGAGTTTCAGACGTTCATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-196s1c1
Sequence:CCGGGCAGTACATGAAGTTCCCTTTCTCGAGAAAGGGAACTTCATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-358s1c1
Sequence:CCGGGCCCAGAACATGTCCAAATATCTCGAGATATTTGGACATGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-220s1c1
Sequence:CCGGGCCAATATTGATATTCGTGATCTCGAGATCACGAATATCAATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-659s1c1
Sequence:CCGGCCTTGAATCAAGAGACTACATCTCGAGATGTAGTCTCTTGATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-397s21c1
Sequence:CCGGGCCCAGAACATGTCCAAATATCTCGAGATATTTGGACATGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-235s21c1
Sequence:CCGGGCAGTACATGAAGTTCCCTTTCTCGAGAAAGGGAACTTCATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-259s21c1
Sequence:CCGGGCCAATATTGATATTCGTGATCTCGAGATCACGAATATCAATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-874s21c1
Sequence:CCGGCCTGAATATGAACGTCTGAAACTCGAGTTTCAGACGTTCATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-698s21c1
Sequence:CCGGCCTTGAATCAAGAGACTACATCTCGAGATGTAGTCTCTTGATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007266
VALIDATED
GPN1 MISSION shRNA Lentiviral Transduction Particles
GPN-loop GTPase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007266.1-835s1c1
Sequence:CCGGCCTGAATATGAACGTCTGAAACTCGAGTTTCAGACGTTCATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-196s1c1
Sequence:CCGGGCAGTACATGAAGTTCCCTTTCTCGAGAAAGGGAACTTCATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-358s1c1
Sequence:CCGGGCCCAGAACATGTCCAAATATCTCGAGATATTTGGACATGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-220s1c1
Sequence:CCGGGCCAATATTGATATTCGTGATCTCGAGATCACGAATATCAATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007266.1-659s1c1
Sequence:CCGGCCTTGAATCAAGAGACTACATCTCGAGATGTAGTCTCTTGATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-397s21c1
Sequence:CCGGGCCCAGAACATGTCCAAATATCTCGAGATATTTGGACATGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-235s21c1
Sequence:CCGGGCAGTACATGAAGTTCCCTTTCTCGAGAAAGGGAACTTCATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-259s21c1
Sequence:CCGGGCCAATATTGATATTCGTGATCTCGAGATCACGAATATCAATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-874s21c1
Sequence:CCGGCCTGAATATGAACGTCTGAAACTCGAGTTTCAGACGTTCATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007266.3-698s21c1
Sequence:CCGGCCTTGAATCAAGAGACTACATCTCGAGATGTAGTCTCTTGATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133756
VALIDATED
GPN1 MISSION shRNA Bacterial Glycerol Stock
GPN-loop GTPase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-1043s1c1
Sequence:CCGGGACCACAGAGTTACAGAGGAACTCGAGTTCCTCTGTAACTCTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-899s1c1
Sequence:CCGGCGGAAGGATATGGGCTCCGTACTCGAGTACGGAGCCCATATCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-347s1c1
Sequence:CCGGGCCCAGAACACATTCAGATATCTCGAGATATCTGAATGTGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-223s1c1
Sequence:CCGGCCGAGACACAGTGAAATATAACTCGAGTTATATTTCACTGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-800s1c1
Sequence:CCGGGAGGAGTACGAAAGGGAATATCTCGAGATATTCCCTTTCGTACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-1042s21c1
Sequence:CCGGGACCACAGAGTTACAGAGGAACTCGAGTTCCTCTGTAACTCTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-799s21c1
Sequence:CCGGGAGGAGTACGAAAGGGAATATCTCGAGATATTCCCTTTCGTACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-346s21c1
Sequence:CCGGGCCCAGAACACATTCAGATATCTCGAGATATCTGAATGTGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-222s21c1
Sequence:CCGGCCGAGACACAGTGAAATATAACTCGAGTTATATTTCACTGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133756
VALIDATED
GPN1 MISSION shRNA shRNA Plasmid DNA
GPN-loop GTPase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-1043s1c1
Sequence:CCGGGACCACAGAGTTACAGAGGAACTCGAGTTCCTCTGTAACTCTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-899s1c1
Sequence:CCGGCGGAAGGATATGGGCTCCGTACTCGAGTACGGAGCCCATATCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-347s1c1
Sequence:CCGGGCCCAGAACACATTCAGATATCTCGAGATATCTGAATGTGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-223s1c1
Sequence:CCGGCCGAGACACAGTGAAATATAACTCGAGTTATATTTCACTGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-800s1c1
Sequence:CCGGGAGGAGTACGAAAGGGAATATCTCGAGATATTCCCTTTCGTACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-1042s21c1
Sequence:CCGGGACCACAGAGTTACAGAGGAACTCGAGTTCCTCTGTAACTCTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-799s21c1
Sequence:CCGGGAGGAGTACGAAAGGGAATATCTCGAGATATTCCCTTTCGTACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-346s21c1
Sequence:CCGGGCCCAGAACACATTCAGATATCTCGAGATATCTGAATGTGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-222s21c1
Sequence:CCGGCCGAGACACAGTGAAATATAACTCGAGTTATATTTCACTGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133756
VALIDATED
GPN1 MISSION shRNA Lentiviral Transduction Particles
GPN-loop GTPase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-1043s1c1
Sequence:CCGGGACCACAGAGTTACAGAGGAACTCGAGTTCCTCTGTAACTCTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-899s1c1
Sequence:CCGGCGGAAGGATATGGGCTCCGTACTCGAGTACGGAGCCCATATCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-347s1c1
Sequence:CCGGGCCCAGAACACATTCAGATATCTCGAGATATCTGAATGTGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-223s1c1
Sequence:CCGGCCGAGACACAGTGAAATATAACTCGAGTTATATTTCACTGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133756.2-800s1c1
Sequence:CCGGGAGGAGTACGAAAGGGAATATCTCGAGATATTCCCTTTCGTACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-1042s21c1
Sequence:CCGGGACCACAGAGTTACAGAGGAACTCGAGTTCCTCTGTAACTCTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-799s21c1
Sequence:CCGGGAGGAGTACGAAAGGGAATATCTCGAGATATTCCCTTTCGTACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-346s21c1
Sequence:CCGGGCCCAGAACACATTCAGATATCTCGAGATATCTGAATGTGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133756.4-222s21c1
Sequence:CCGGCCGAGACACAGTGAAATATAACTCGAGTTATATTTCACTGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks