EMAIL THIS PAGE TO A FRIEND

GPN2

GPN-loop GTPase 2

68 Gene Product Result for
Synonyms: ATPBD1B
UniProtKB ID: Q9H9Y4, Q96HG4, Q9NUE1, Q9NW30
Gene ID:
Mouse(100210) GPN-loop GTPase 2
Rat(362614) GPN-loop GTPase 2
domestic guinea pig(100727122) GPN-loop GTPase 2
naked mole-rat(101719960) GPN-loop GTPase 2
sheep(101114759) GPN-loop GTPase 2
Zebrafish(407722) GPN-loop GTPase 2
chicken(419576) GPN-loop GTPase 2
dog(610227) GPN-loop GTPase 2
cow(514772) GPN-loop GTPase 2
domestic cat(101087760) GPN-loop GTPase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018066 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047341 MISSION® esiRNA esiRNA human GPN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018066 Rosetta Predictions human pricing
XM_001066907 Rosetta Predictions rat pricing
XM_342932 Rosetta Predictions rat pricing
NM_133884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139194 predicted 791
2 SASI_Hs01_00139195 predicted 513
3 SASI_Hs01_00139196 predicted 1199
4 SASI_Hs01_00139197 predicted 822
5 SASI_Hs01_00139198 predicted 1092
6 SASI_Hs01_00139199 predicted 1048
7 SASI_Hs02_00351209 predicted 994
8 SASI_Hs01_00139200 predicted 1075
9 SASI_Hs01_00139201 predicted 734
10 SASI_Hs01_00139202 predicted 591
11 SASI_Hs01_00139203 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319172 predicted 576
2 SASI_Rn02_00319173 predicted 1148
3 SASI_Rn02_00319174 predicted 1089
4 SASI_Rn02_00319175 predicted 425
5 SASI_Rn02_00319176 predicted 1039
6 SASI_Rn02_00319177 predicted 870
7 SASI_Rn02_00319178 predicted 549
8 SASI_Rn02_00319179 predicted 649
9 SASI_Rn02_00319180 predicted 265
10 SASI_Rn02_00319181 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395051 predicted 263
2 SASI_Rn02_00395052 predicted 262
3 SASI_Rn02_00395053 predicted 253
4 SASI_Rn02_00395054 predicted 264
5 SASI_Rn02_00395055 predicted 271
6 SASI_Rn02_00395056 predicted 243
7 SASI_Rn02_00395057 predicted 264
8 SASI_Rn02_00395058 predicted 255
9 SASI_Rn02_00395059 predicted 256
10 SASI_Rn02_00395060 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040460 predicted 826
2 SASI_Mm01_00040461 predicted 591
3 SASI_Mm01_00040462 predicted 385
4 SASI_Mm01_00040463 predicted 528
5 SASI_Mm01_00040464 predicted 314
6 SASI_Mm02_00338941 predicted 948
7 SASI_Mm01_00040466 predicted 531
8 SASI_Mm01_00040467 predicted 564
9 SASI_Mm01_00040468 predicted 991
10 SASI_Mm01_00040469 predicted 618
11 SASI_Mm01_00040465 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018066
VALIDATED
GPN2 MISSION shRNA Bacterial Glycerol Stock
GPN-loop GTPase 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-654s21c1
Sequence:CCGGGCGCAGCATCTTCTCCCAAATCTCGAGATTTGGGAGAAGATGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-850s21c1
Sequence:CCGGGCCTTCAACCTGGACTACTACCTCGAGGTAGTAGTCCAGGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-1336s21c1
Sequence:CCGGGGGATATTCAGCTCTGCAAAGCTCGAGCTTTGCAGAGCTGAATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-731s21c1
Sequence:CCGGCAGACCCTGCCAAGTTCATTTCTCGAGAAATGAACTTGGCAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-1230s21c1
Sequence:CCGGCTGGAGAGCAGGATGCATAATCTCGAGATTATGCATCCTGCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-820s21c1
Sequence:CCGGATGGACCTCATTGAGCATTATCTCGAGATAATGCTCAATGAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018066.3-915s21c1
Sequence:CCGGTGACCCTTTCTTCCGCCACTACTCGAGTAGTGGCGGAAGAAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018066.2-2340s1c1
Sequence:CCGGGCCTGGGTAACAAGATGGAAACTCGAGTTTCCATCTTGTTACCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-851s1c1
Sequence:CCGGGCTCAATGAGAAGCTAGTGCACTCGAGTGCACTAGCTTCTCATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-948s1c1
Sequence:CCGGCAGGCTGTGGATAAAGCCAATCTCGAGATTGGCTTTATCCACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-873s1c1
Sequence:CCGGCTCATCGAAGACTATAGCCTTCTCGAGAAGGCTATAGTCTTCGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018066.2-2242s1c1
Sequence:CCGGGCCTGTAATTCCAGCTACTTACTCGAGTAAGTAGCTGGAATTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018066.2-728s1c1
Sequence:CCGGGATGGACCTCATTGAGCATTACTCGAGTAATGCTCAATGAGGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-645s1c1
Sequence:CCGGCCTGCCAAGTTCATTTCAGTACTCGAGTACTGAAATGAACTTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018066
VALIDATED
GPN2 MISSION shRNA shRNA Plasmid DNA
GPN-loop GTPase 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-654s21c1
Sequence:CCGGGCGCAGCATCTTCTCCCAAATCTCGAGATTTGGGAGAAGATGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-850s21c1
Sequence:CCGGGCCTTCAACCTGGACTACTACCTCGAGGTAGTAGTCCAGGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-1336s21c1
Sequence:CCGGGGGATATTCAGCTCTGCAAAGCTCGAGCTTTGCAGAGCTGAATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-731s21c1
Sequence:CCGGCAGACCCTGCCAAGTTCATTTCTCGAGAAATGAACTTGGCAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-1230s21c1
Sequence:CCGGCTGGAGAGCAGGATGCATAATCTCGAGATTATGCATCCTGCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-820s21c1
Sequence:CCGGATGGACCTCATTGAGCATTATCTCGAGATAATGCTCAATGAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018066.3-915s21c1
Sequence:CCGGTGACCCTTTCTTCCGCCACTACTCGAGTAGTGGCGGAAGAAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018066.2-2340s1c1
Sequence:CCGGGCCTGGGTAACAAGATGGAAACTCGAGTTTCCATCTTGTTACCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-851s1c1
Sequence:CCGGGCTCAATGAGAAGCTAGTGCACTCGAGTGCACTAGCTTCTCATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-948s1c1
Sequence:CCGGCAGGCTGTGGATAAAGCCAATCTCGAGATTGGCTTTATCCACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-873s1c1
Sequence:CCGGCTCATCGAAGACTATAGCCTTCTCGAGAAGGCTATAGTCTTCGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018066.2-2242s1c1
Sequence:CCGGGCCTGTAATTCCAGCTACTTACTCGAGTAAGTAGCTGGAATTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018066.2-728s1c1
Sequence:CCGGGATGGACCTCATTGAGCATTACTCGAGTAATGCTCAATGAGGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-645s1c1
Sequence:CCGGCCTGCCAAGTTCATTTCAGTACTCGAGTACTGAAATGAACTTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018066
VALIDATED
GPN2 MISSION shRNA Lentiviral Transduction Particles
GPN-loop GTPase 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-654s21c1
Sequence:CCGGGCGCAGCATCTTCTCCCAAATCTCGAGATTTGGGAGAAGATGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-850s21c1
Sequence:CCGGGCCTTCAACCTGGACTACTACCTCGAGGTAGTAGTCCAGGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-1336s21c1
Sequence:CCGGGGGATATTCAGCTCTGCAAAGCTCGAGCTTTGCAGAGCTGAATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-731s21c1
Sequence:CCGGCAGACCCTGCCAAGTTCATTTCTCGAGAAATGAACTTGGCAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-1230s21c1
Sequence:CCGGCTGGAGAGCAGGATGCATAATCTCGAGATTATGCATCCTGCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018066.3-820s21c1
Sequence:CCGGATGGACCTCATTGAGCATTATCTCGAGATAATGCTCAATGAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018066.3-915s21c1
Sequence:CCGGTGACCCTTTCTTCCGCCACTACTCGAGTAGTGGCGGAAGAAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018066.2-2340s1c1
Sequence:CCGGGCCTGGGTAACAAGATGGAAACTCGAGTTTCCATCTTGTTACCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-851s1c1
Sequence:CCGGGCTCAATGAGAAGCTAGTGCACTCGAGTGCACTAGCTTCTCATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-948s1c1
Sequence:CCGGCAGGCTGTGGATAAAGCCAATCTCGAGATTGGCTTTATCCACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-873s1c1
Sequence:CCGGCTCATCGAAGACTATAGCCTTCTCGAGAAGGCTATAGTCTTCGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018066.2-2242s1c1
Sequence:CCGGGCCTGTAATTCCAGCTACTTACTCGAGTAAGTAGCTGGAATTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018066.2-728s1c1
Sequence:CCGGGATGGACCTCATTGAGCATTACTCGAGTAATGCTCAATGAGGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018066.2-645s1c1
Sequence:CCGGCCTGCCAAGTTCATTTCAGTACTCGAGTACTGAAATGAACTTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133884
VALIDATED
GPN2 MISSION shRNA Bacterial Glycerol Stock
GPN-loop GTPase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133884.1-836s1c1
Sequence:CCGGCAGGCTGTGGATAAAGCTAATCTCGAGATTAGCTTTATCCACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-572s21c1
Sequence:CCGGACCATGCTGCACGTGGAATTGCTCGAGCAATTCCACGTGCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-1120s21c1
Sequence:CCGGTAGAGAAGAAGCCACGCATAGCTCGAGCTATGCGTGGCTTCTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-948s21c1
Sequence:CCGGGCATCCAGGAGAAGTACTTAGCTCGAGCTAAGTACTTCTCCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-609s21c1
Sequence:CCGGTCTCCAAGATGGACCTTATTGCTCGAGCAATAAGGTCCATCTTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-816s21c1
Sequence:CCGGACAGCATCCAGCGAGTCTTACCTCGAGGTAAGACTCGCTGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133884.1-616s1c1
Sequence:CCGGGATGGACCTTATTGAACACTACTCGAGTAGTGTTCAATAAGGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133884.1-1119s1c1
Sequence:CCGGCTAGAGAAGAAGCCACGCATACTCGAGTATGCGTGGCTTCTTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133884.1-1101s1c1
Sequence:CCGGCATCCCTGCAAAGGACTTCTACTCGAGTAGAAGTCCTTTGCAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133884
VALIDATED
GPN2 MISSION shRNA shRNA Plasmid DNA
GPN-loop GTPase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133884.1-836s1c1
Sequence:CCGGCAGGCTGTGGATAAAGCTAATCTCGAGATTAGCTTTATCCACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-572s21c1
Sequence:CCGGACCATGCTGCACGTGGAATTGCTCGAGCAATTCCACGTGCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-1120s21c1
Sequence:CCGGTAGAGAAGAAGCCACGCATAGCTCGAGCTATGCGTGGCTTCTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-948s21c1
Sequence:CCGGGCATCCAGGAGAAGTACTTAGCTCGAGCTAAGTACTTCTCCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-609s21c1
Sequence:CCGGTCTCCAAGATGGACCTTATTGCTCGAGCAATAAGGTCCATCTTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-816s21c1
Sequence:CCGGACAGCATCCAGCGAGTCTTACCTCGAGGTAAGACTCGCTGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133884.1-616s1c1
Sequence:CCGGGATGGACCTTATTGAACACTACTCGAGTAGTGTTCAATAAGGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133884.1-1119s1c1
Sequence:CCGGCTAGAGAAGAAGCCACGCATACTCGAGTATGCGTGGCTTCTTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133884.1-1101s1c1
Sequence:CCGGCATCCCTGCAAAGGACTTCTACTCGAGTAGAAGTCCTTTGCAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133884
VALIDATED
GPN2 MISSION shRNA Lentiviral Transduction Particles
GPN-loop GTPase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133884.1-836s1c1
Sequence:CCGGCAGGCTGTGGATAAAGCTAATCTCGAGATTAGCTTTATCCACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-572s21c1
Sequence:CCGGACCATGCTGCACGTGGAATTGCTCGAGCAATTCCACGTGCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-1120s21c1
Sequence:CCGGTAGAGAAGAAGCCACGCATAGCTCGAGCTATGCGTGGCTTCTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-948s21c1
Sequence:CCGGGCATCCAGGAGAAGTACTTAGCTCGAGCTAAGTACTTCTCCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-609s21c1
Sequence:CCGGTCTCCAAGATGGACCTTATTGCTCGAGCAATAAGGTCCATCTTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133884.1-816s21c1
Sequence:CCGGACAGCATCCAGCGAGTCTTACCTCGAGGTAAGACTCGCTGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133884.1-616s1c1
Sequence:CCGGGATGGACCTTATTGAACACTACTCGAGTAGTGTTCAATAAGGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133884.1-1119s1c1
Sequence:CCGGCTAGAGAAGAAGCCACGCATACTCGAGTATGCGTGGCTTCTTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133884.1-1101s1c1
Sequence:CCGGCATCCCTGCAAAGGACTTCTACTCGAGTAGAAGTCCTTTGCAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks