EMAIL THIS PAGE TO A FRIEND

GPN3

GPN-loop GTPase 3

Synonyms: ATPBD1C
Gene ID:
Mouse(68080) GPN-loop GTPase 3
Rat(360810) GPN-loop GTPase 3
Zebrafish(100000326) GPN-loop GTPase 3
chicken(427696) GPN-loop GTPase 3
dog(477475) GPN-loop GTPase 3
domestic cat(101098898) GPN-loop GTPase 3
cow(506597) GPN-loop GTPase 3
domestic guinea pig(100727910) GPN-loop GTPase 3
naked mole-rat(101717952) GPN-loop GTPase 3
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016301 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016301 Rosetta Predictions human pricing
NM_201991 Rosetta Predictions rat pricing
NM_024216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185358 predicted 326
2 SASI_Hs02_00349224 predicted 818
3 SASI_Hs02_00349225 predicted 938
4 SASI_Hs02_00349226 predicted 897
5 SASI_Hs01_00185360 predicted 220
6 SASI_Hs01_00185361 predicted 850
7 SASI_Hs01_00185362 predicted 334
8 SASI_Hs01_00185363 predicted 866
9 SASI_Hs01_00185364 predicted 1180
10 SASI_Hs01_00185365 predicted 294
11 SASI_Hs01_00185359 predicted 1039
12 SASI_Hs01_00185366 predicted 330
13 SASI_Hs01_00185367 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270348 predicted 284
2 SASI_Rn01_00100292 predicted 895
3 SASI_Rn01_00100293 predicted 700
4 SASI_Rn01_00100295 predicted 538
5 SASI_Rn02_00270349 predicted 485
6 SASI_Rn01_00100296 predicted 929
7 SASI_Rn01_00100297 predicted 296
8 SASI_Rn01_00100298 predicted 274
9 SASI_Rn01_00100299 predicted 772
10 SASI_Rn01_00100300 predicted 646
11 SASI_Rn01_00100294 predicted 906
12 SASI_Rn01_00100301 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107711 predicted 349
2 SASI_Mm01_00107712 predicted 959
3 SASI_Mm01_00107713 predicted 916
4 SASI_Mm01_00107714 predicted 706
5 SASI_Mm02_00327586 predicted 332
6 SASI_Mm01_00107715 predicted 354
7 SASI_Mm01_00107716 predicted 537
8 SASI_Mm01_00107717 predicted 825
9 SASI_Mm01_00107718 predicted 511
10 SASI_Mm01_00107719 predicted 431
11 SASI_Mm01_00107720 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024216
VALIDATED
GPN3 MISSION shRNA Bacterial Glycerol Stock
GPN-loop GTPase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-1136s1c1
Sequence:CCGGCCGCTCTTTCAGGAGACTTTACTCGAGTAAAGTCTCCTGAAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-350s1c1
Sequence:CCGGGCATGGAGTACTTTGCCAATACTCGAGTATTGGCAAAGTACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-642s1c1
Sequence:CCGGCCTGCTGAGTAAGAAAGCCAACTCGAGTTGGCTTTCTTACTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-923s1c1
Sequence:CCGGCCTCCATGTTTGATGAGTATTCTCGAGAATACTCATCAAACATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-514s21c1
Sequence:CCGGTGCGGAGTGTTCCTTGTTGATCTCGAGATCAACAAGGAACACTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-642s21c1
Sequence:CCGGCCTGCTGAGTAAGAAAGCCAACTCGAGTTGGCTTTCTTACTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-350s21c1
Sequence:CCGGGCATGGAGTACTTTGCCAATACTCGAGTATTGGCAAAGTACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-923s21c1
Sequence:CCGGCCTCCATGTTTGATGAGTATTCTCGAGAATACTCATCAAACATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024216.1-1136s21c1
Sequence:CCGGCCGCTCTTTCAGGAGACTTTACTCGAGTAAAGTCTCCTGAAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024216
VALIDATED
GPN3 MISSION shRNA shRNA Plasmid DNA
GPN-loop GTPase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-1136s1c1
Sequence:CCGGCCGCTCTTTCAGGAGACTTTACTCGAGTAAAGTCTCCTGAAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-350s1c1
Sequence:CCGGGCATGGAGTACTTTGCCAATACTCGAGTATTGGCAAAGTACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-642s1c1
Sequence:CCGGCCTGCTGAGTAAGAAAGCCAACTCGAGTTGGCTTTCTTACTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-923s1c1
Sequence:CCGGCCTCCATGTTTGATGAGTATTCTCGAGAATACTCATCAAACATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-514s21c1
Sequence:CCGGTGCGGAGTGTTCCTTGTTGATCTCGAGATCAACAAGGAACACTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-642s21c1
Sequence:CCGGCCTGCTGAGTAAGAAAGCCAACTCGAGTTGGCTTTCTTACTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-350s21c1
Sequence:CCGGGCATGGAGTACTTTGCCAATACTCGAGTATTGGCAAAGTACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-923s21c1
Sequence:CCGGCCTCCATGTTTGATGAGTATTCTCGAGAATACTCATCAAACATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024216.1-1136s21c1
Sequence:CCGGCCGCTCTTTCAGGAGACTTTACTCGAGTAAAGTCTCCTGAAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024216
VALIDATED
GPN3 MISSION shRNA Lentiviral Transduction Particles
GPN-loop GTPase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-1136s1c1
Sequence:CCGGCCGCTCTTTCAGGAGACTTTACTCGAGTAAAGTCTCCTGAAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-350s1c1
Sequence:CCGGGCATGGAGTACTTTGCCAATACTCGAGTATTGGCAAAGTACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-642s1c1
Sequence:CCGGCCTGCTGAGTAAGAAAGCCAACTCGAGTTGGCTTTCTTACTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024216.1-923s1c1
Sequence:CCGGCCTCCATGTTTGATGAGTATTCTCGAGAATACTCATCAAACATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-514s21c1
Sequence:CCGGTGCGGAGTGTTCCTTGTTGATCTCGAGATCAACAAGGAACACTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-642s21c1
Sequence:CCGGCCTGCTGAGTAAGAAAGCCAACTCGAGTTGGCTTTCTTACTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-350s21c1
Sequence:CCGGGCATGGAGTACTTTGCCAATACTCGAGTATTGGCAAAGTACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024216.1-923s21c1
Sequence:CCGGCCTCCATGTTTGATGAGTATTCTCGAGAATACTCATCAAACATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024216.1-1136s21c1
Sequence:CCGGCCGCTCTTTCAGGAGACTTTACTCGAGTAAAGTCTCCTGAAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016301
VALIDATED
GPN3 MISSION shRNA Bacterial Glycerol Stock
GPN-loop GTPase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-750s1c1
Sequence:CCGGCCTTACGATCAGTCAGATGAACTCGAGTTCATCTGACTGATCGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-343s1c1
Sequence:CCGGGCCATGTAGAGGACGACTATACTCGAGTATAGTCGTCCTCTACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-492s1c1
Sequence:CCGGGTGGAGTCATTCAAGTTTATTCTCGAGAATAAACTTGAATGACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-237s1c1
Sequence:CCGGGATGATGTAATGGAGGATGATCTCGAGATCATCCTCCATTACATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-868s1c1
Sequence:CCGGCCTCTATGTTTGACGAATATTCTCGAGAATATTCGTCAAACATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_016301.2-868s21c1
Sequence:CCGGCCTCTATGTTTGACGAATATTCTCGAGAATATTCGTCAAACATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016301.2-343s21c1
Sequence:CCGGGCCATGTAGAGGACGACTATACTCGAGTATAGTCGTCCTCTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016301.2-237s21c1
Sequence:CCGGGATGATGTAATGGAGGATGATCTCGAGATCATCCTCCATTACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016301.2-750s21c1
Sequence:CCGGCCTTACGATCAGTCAGATGAACTCGAGTTCATCTGACTGATCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016301.2-492s21c1
Sequence:CCGGGTGGAGTCATTCAAGTTTATTCTCGAGAATAAACTTGAATGACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016301
VALIDATED
GPN3 MISSION shRNA shRNA Plasmid DNA
GPN-loop GTPase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-750s1c1
Sequence:CCGGCCTTACGATCAGTCAGATGAACTCGAGTTCATCTGACTGATCGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-343s1c1
Sequence:CCGGGCCATGTAGAGGACGACTATACTCGAGTATAGTCGTCCTCTACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-492s1c1
Sequence:CCGGGTGGAGTCATTCAAGTTTATTCTCGAGAATAAACTTGAATGACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-237s1c1
Sequence:CCGGGATGATGTAATGGAGGATGATCTCGAGATCATCCTCCATTACATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-868s1c1
Sequence:CCGGCCTCTATGTTTGACGAATATTCTCGAGAATATTCGTCAAACATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_016301.2-868s21c1
Sequence:CCGGCCTCTATGTTTGACGAATATTCTCGAGAATATTCGTCAAACATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016301.2-343s21c1
Sequence:CCGGGCCATGTAGAGGACGACTATACTCGAGTATAGTCGTCCTCTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016301.2-237s21c1
Sequence:CCGGGATGATGTAATGGAGGATGATCTCGAGATCATCCTCCATTACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016301.2-750s21c1
Sequence:CCGGCCTTACGATCAGTCAGATGAACTCGAGTTCATCTGACTGATCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016301.2-492s21c1
Sequence:CCGGGTGGAGTCATTCAAGTTTATTCTCGAGAATAAACTTGAATGACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016301
VALIDATED
GPN3 MISSION shRNA Lentiviral Transduction Particles
GPN-loop GTPase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-750s1c1
Sequence:CCGGCCTTACGATCAGTCAGATGAACTCGAGTTCATCTGACTGATCGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-343s1c1
Sequence:CCGGGCCATGTAGAGGACGACTATACTCGAGTATAGTCGTCCTCTACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-492s1c1
Sequence:CCGGGTGGAGTCATTCAAGTTTATTCTCGAGAATAAACTTGAATGACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-237s1c1
Sequence:CCGGGATGATGTAATGGAGGATGATCTCGAGATCATCCTCCATTACATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016301.2-868s1c1
Sequence:CCGGCCTCTATGTTTGACGAATATTCTCGAGAATATTCGTCAAACATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_016301.2-868s21c1
Sequence:CCGGCCTCTATGTTTGACGAATATTCTCGAGAATATTCGTCAAACATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016301.2-343s21c1
Sequence:CCGGGCCATGTAGAGGACGACTATACTCGAGTATAGTCGTCCTCTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016301.2-237s21c1
Sequence:CCGGGATGATGTAATGGAGGATGATCTCGAGATCATCCTCCATTACATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016301.2-750s21c1
Sequence:CCGGCCTTACGATCAGTCAGATGAACTCGAGTTCATCTGACTGATCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016301.2-492s21c1
Sequence:CCGGGTGGAGTCATTCAAGTTTATTCTCGAGAATAAACTTGAATGACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks