EMAIL THIS PAGE TO A FRIEND

GPNMB

glycoprotein (transmembrane) nmb

Synonyms: HGFIN NMB
UniProtKB ID: Q14956, A4D155, Q6UVX1, Q8N1A1
Gene ID:
Human(10457) Summary: The protein encoded by this gene is a type I transmembrane glycoprotein which shows homology to the pMEL17 precursor, a melanocyte-specific protein. GPNMB shows expression in the lowly metastatic human melanoma cell lines and xenografts but does not show expression in the highly metastatic cell lines. GPNMB may be involved in growth delay and reduction of metastatic potential. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(93695) glycoprotein (transmembrane) nmb
Rat(113955) glycoprotein (transmembrane) nmb
Zebrafish(563348) glycoprotein (transmembrane) nmb
chicken(428431) glycoprotein (transmembrane) nmb
domestic cat(101090001) glycoprotein (transmembrane) nmb
cow(509600) glycoprotein (transmembrane) nmb
Horse(100067870) glycoprotein (transmembrane) nmb
dog(482355) glycoprotein (transmembrane) nmb
domestic guinea pig(100734622) glycoprotein (transmembrane) nmb
naked mole-rat(101726702) glycoprotein (transmembrane) nmb
sheep(101109959) glycoprotein (transmembrane) nmb
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053110 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053110 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053110 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002510 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005340 Rosetta Predictions human pricing
NM_002510 Rosetta Predictions human pricing
NM_133298 Rosetta Predictions rat pricing
NM_053110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089469 predicted 720
2 SASI_Hs01_00089470 predicted 667
3 SASI_Hs01_00089471 predicted 785
4 SASI_Hs01_00089472 predicted 513
5 SASI_Hs01_00089473 predicted 756
6 SASI_Hs01_00089474 predicted 266
7 SASI_Hs01_00089475 predicted 1853
8 SASI_Hs02_00304854 predicted 244
9 SASI_Hs01_00089477 predicted 1864
10 SASI_Hs01_00089478 predicted 1492
11 SASI_Hs01_00089476 predicted 1689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136972 predicted 719
2 SASI_Hs01_00136973 predicted 667
3 SASI_Hs01_00136974 predicted 776
4 SASI_Hs01_00136975 predicted 517
5 SASI_Hs01_00136976 predicted 751
6 SASI_Hs01_00136977 predicted 262
7 SASI_Hs01_00136978 predicted 1813
8 SASI_Hs02_00333974 predicted 250
9 SASI_Hs01_00136980 predicted 1826
10 SASI_Hs01_00136981 predicted 1462
11 SASI_Hs01_00136979 predicted 1644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050006 predicted 233
2 SASI_Rn01_00050007 predicted 729
3 SASI_Rn01_00050008 predicted 1599
4 SASI_Rn02_00267593 predicted 1824
5 SASI_Rn01_00050010 predicted 1025
6 SASI_Rn01_00050011 predicted 1330
7 SASI_Rn01_00050012 predicted 1658
8 SASI_Rn01_00050013 predicted 620
9 SASI_Rn01_00050014 predicted 809
10 SASI_Rn02_00267594 predicted 981
11 SASI_Rn01_00050009 predicted 1256
12 SASI_Rn01_00050015 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147442 predicted 1697
2 SASI_Mm01_00147444 predicted 829
3 SASI_Mm01_00147445 predicted 1749
4 SASI_Mm02_00337619 predicted 617
5 SASI_Mm02_00337620 predicted 286
6 SASI_Mm01_00147447 predicted 1381
7 SASI_Mm01_00147448 predicted 1913
8 SASI_Mm01_00147446 predicted 312
9 SASI_Mm01_00147449 predicted 1101
10 SASI_Mm01_00147451 predicted 856
11 SASI_Mm01_00147443 predicted 1217
12 SASI_Mm01_00147450 predicted 971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053110
VALIDATED
GPNMB MISSION shRNA Bacterial Glycerol Stock
glycoprotein (transmembrane) nmb
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-717s21c1
Sequence:CCGGGGAGCTTTGTCTACGTCTTTCCTCGAGGAAAGACGTAGACAAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-2364s21c1
Sequence:CCGGGTGTACATATTCTACTCATTACTCGAGTAATGAGTAGAATATGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053110.4-1263s21c1
Sequence:CCGGCCTCTTTAATGCCTACTGGTTCTCGAGAACCAGTAGGCATTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-533s21c1
Sequence:CCGGGCTAATGGCAATATCGTCTATCTCGAGATAGACGATATTGCCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-887s21c1
Sequence:CCGGGATGTGTATGTGATAACAGATCTCGAGATCTGTTATCACATACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053110.2-2527s1c1
Sequence:CCGGCCCAAATAACTAGATGGTATTCTCGAGAATACCATCTAGTTATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053110.2-781s1c1
Sequence:CCGGGATGTGTATGTGATAACAGATCTCGAGATCTGTTATCACATACACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053110.2-1218s1c1
Sequence:CCGGCCGAATAAACAGATATGGCTACTCGAGTAGCCATATCTGTTTATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053110.2-1157s1c1
Sequence:CCGGCCTCTTTAATGCCTACTGGTTCTCGAGAACCAGTAGGCATTAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053110.2-427s1c1
Sequence:CCGGGCTAATGGCAATATCGTCTATCTCGAGATAGACGATATTGCCATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053110
VALIDATED
GPNMB MISSION shRNA shRNA Plasmid DNA
glycoprotein (transmembrane) nmb
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-717s21c1
Sequence:CCGGGGAGCTTTGTCTACGTCTTTCCTCGAGGAAAGACGTAGACAAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-2364s21c1
Sequence:CCGGGTGTACATATTCTACTCATTACTCGAGTAATGAGTAGAATATGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053110.4-1263s21c1
Sequence:CCGGCCTCTTTAATGCCTACTGGTTCTCGAGAACCAGTAGGCATTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-533s21c1
Sequence:CCGGGCTAATGGCAATATCGTCTATCTCGAGATAGACGATATTGCCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-887s21c1
Sequence:CCGGGATGTGTATGTGATAACAGATCTCGAGATCTGTTATCACATACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053110.2-2527s1c1
Sequence:CCGGCCCAAATAACTAGATGGTATTCTCGAGAATACCATCTAGTTATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053110.2-781s1c1
Sequence:CCGGGATGTGTATGTGATAACAGATCTCGAGATCTGTTATCACATACACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053110.2-1218s1c1
Sequence:CCGGCCGAATAAACAGATATGGCTACTCGAGTAGCCATATCTGTTTATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053110.2-1157s1c1
Sequence:CCGGCCTCTTTAATGCCTACTGGTTCTCGAGAACCAGTAGGCATTAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053110.2-427s1c1
Sequence:CCGGGCTAATGGCAATATCGTCTATCTCGAGATAGACGATATTGCCATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053110
VALIDATED
GPNMB MISSION shRNA Lentiviral Transduction Particles
glycoprotein (transmembrane) nmb
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-717s21c1
Sequence:CCGGGGAGCTTTGTCTACGTCTTTCCTCGAGGAAAGACGTAGACAAAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-2364s21c1
Sequence:CCGGGTGTACATATTCTACTCATTACTCGAGTAATGAGTAGAATATGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053110.4-1263s21c1
Sequence:CCGGCCTCTTTAATGCCTACTGGTTCTCGAGAACCAGTAGGCATTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-533s21c1
Sequence:CCGGGCTAATGGCAATATCGTCTATCTCGAGATAGACGATATTGCCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053110.4-887s21c1
Sequence:CCGGGATGTGTATGTGATAACAGATCTCGAGATCTGTTATCACATACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053110.2-2527s1c1
Sequence:CCGGCCCAAATAACTAGATGGTATTCTCGAGAATACCATCTAGTTATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053110.2-781s1c1
Sequence:CCGGGATGTGTATGTGATAACAGATCTCGAGATCTGTTATCACATACACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053110.2-1218s1c1
Sequence:CCGGCCGAATAAACAGATATGGCTACTCGAGTAGCCATATCTGTTTATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053110.2-1157s1c1
Sequence:CCGGCCTCTTTAATGCCTACTGGTTCTCGAGAACCAGTAGGCATTAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053110.2-427s1c1
Sequence:CCGGGCTAATGGCAATATCGTCTATCTCGAGATAGACGATATTGCCATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002510
VALIDATED
GPNMB MISSION shRNA Bacterial Glycerol Stock
glycoprotein (transmembrane) nmb
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002510.1-131s1c1
Sequence:CCGGGCTGCAAGATTGCCACTTGATCTCGAGATCAAGTGGCAATCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002510.1-1619s1c1
Sequence:CCGGCACAAGGAATACAACCCAATACTCGAGTATTGGGTTGTATTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002510.1-1961s1c1
Sequence:CCGGGCCATGTTGTGAAACTGATAACTCGAGTTATCAGTTTCACAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002510.1-1680s1c1
Sequence:CCGGGTGTCTTTCTCAACCGTGCAACTCGAGTTGCACGGTTGAGAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002510.1-1984s1c1
Sequence:CCGGGCAACTTAGCAAGGCTTCTTTCTCGAGAAAGAAGCCTTGCTAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002510.1-760s1c1
Sequence:CCGGCGCACAAGTGAAAGATGTGTACTCGAGTACACATCTTTCACTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002510
VALIDATED
GPNMB MISSION shRNA shRNA Plasmid DNA
glycoprotein (transmembrane) nmb
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002510.1-131s1c1
Sequence:CCGGGCTGCAAGATTGCCACTTGATCTCGAGATCAAGTGGCAATCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002510.1-1619s1c1
Sequence:CCGGCACAAGGAATACAACCCAATACTCGAGTATTGGGTTGTATTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002510.1-1961s1c1
Sequence:CCGGGCCATGTTGTGAAACTGATAACTCGAGTTATCAGTTTCACAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002510.1-1680s1c1
Sequence:CCGGGTGTCTTTCTCAACCGTGCAACTCGAGTTGCACGGTTGAGAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002510.1-1984s1c1
Sequence:CCGGGCAACTTAGCAAGGCTTCTTTCTCGAGAAAGAAGCCTTGCTAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002510.1-760s1c1
Sequence:CCGGCGCACAAGTGAAAGATGTGTACTCGAGTACACATCTTTCACTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002510
VALIDATED
GPNMB MISSION shRNA Lentiviral Transduction Particles
glycoprotein (transmembrane) nmb
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002510.1-131s1c1
Sequence:CCGGGCTGCAAGATTGCCACTTGATCTCGAGATCAAGTGGCAATCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002510.1-1619s1c1
Sequence:CCGGCACAAGGAATACAACCCAATACTCGAGTATTGGGTTGTATTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002510.1-1961s1c1
Sequence:CCGGGCCATGTTGTGAAACTGATAACTCGAGTTATCAGTTTCACAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002510.1-1680s1c1
Sequence:CCGGGTGTCTTTCTCAACCGTGCAACTCGAGTTGCACGGTTGAGAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002510.1-1984s1c1
Sequence:CCGGGCAACTTAGCAAGGCTTCTTTCTCGAGAAAGAAGCCTTGCTAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002510.1-760s1c1
Sequence:CCGGCGCACAAGTGAAAGATGTGTACTCGAGTACACATCTTTCACTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks