EMAIL THIS PAGE TO A FRIEND

GPR101

G protein-coupled receptor 101

Synonyms: GPCR6
UniProtKB ID: Q96P66, Q5JSM8, Q8NG93
Gene ID:
Human(83550) Summary: The protein encoded by this gene is an orphan G protein-coupled receptor of unknown function. The encoded protein is a member of a family of proteins that contain seven transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. [provided by RefSeq, Sep 2011]
Mouse(245424) G protein-coupled receptor 101
Rat(317608) G protein-coupled receptor 101
domestic cat(101084177) G protein-coupled receptor 101
dog(492167) G protein-coupled receptor 101
cow(538781) G protein-coupled receptor 101
domestic guinea pig(100733096) G protein-coupled receptor 101
naked mole-rat(101697948) G protein-coupled receptor 101
Domestic Rabbit(100353309) G protein-coupled receptor 101
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054021 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030741 MISSION® esiRNA esiRNA human GPR101 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054021 Rosetta Predictions human pricing
NM_001108258 Rosetta Predictions rat pricing
NM_001033360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038815 predicted 694
2 SASI_Hs01_00038816 predicted 584
3 SASI_Hs01_00038818 predicted 707
4 SASI_Hs01_00038819 predicted 870
5 SASI_Hs01_00038820 predicted 1059
6 SASI_Hs01_00038821 predicted 627
7 SASI_Hs01_00038823 predicted 403
8 SASI_Hs02_00361943 predicted 351
9 SASI_Hs01_00038824 predicted 1026
10 SASI_Hs02_00361944 predicted 656
11 SASI_Hs01_00038817 predicted 594
12 SASI_Hs01_00038822 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236884 predicted 1614
2 SASI_Rn02_00236885 predicted 841
3 SASI_Rn02_00236886 predicted 582
4 SASI_Rn02_00236887 predicted 751
5 SASI_Rn02_00236888 predicted 1585
6 SASI_Rn02_00236889 predicted 1071
7 SASI_Rn02_00236890 predicted 368
8 SASI_Rn02_00236891 predicted 1134
9 SASI_Rn02_00236892 predicted 852
10 SASI_Rn02_00236893 predicted 1572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097105 predicted 863
2 SASI_Mm01_00097106 predicted 1139
3 SASI_Mm01_00097107 predicted 1649
4 SASI_Mm01_00097108 predicted 1769
5 SASI_Mm01_00097109 predicted 254
6 SASI_Mm01_00097110 predicted 1291
7 SASI_Mm01_00097111 predicted 387
8 SASI_Mm02_00288661 predicted 1759
9 SASI_Mm01_00097113 predicted 1869
10 SASI_Mm01_00097114 predicted 1588
11 SASI_Mm01_00097112 predicted 1763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054021
GPR101 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 101
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054021.1-599s21c1
Sequence:CCGGTCATCGTCATTCCACTGATTGCTCGAGCAATCAGTGGAATGACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054021.1-1296s21c1
Sequence:CCGGCCAGTGGGTGATCACCATAATCTCGAGATTATGGTGATCACCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-1368s1c1
Sequence:CCGGCATGCACAAGACCATTAAGAACTCGAGTTCTTAATGGTCTTGTGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-589s1c1
Sequence:CCGGGTGGTGTCCTTCATCGTCATTCTCGAGAATGACGATGAAGGACACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-439s1c1
Sequence:CCGGCGCGGTTACCTGCTCCTCTATCTCGAGATAGAGGAGCAGGTAACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-1168s1c1
Sequence:CCGGCCCAGGTGCTACCAGTGCAAACTCGAGTTTGCACTGGTAGCACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-129s1c1
Sequence:CCGGCGCCTCTTTCGTCGGCAACATCTCGAGATGTTGCCGACGAAAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054021
GPR101 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 101
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054021.1-599s21c1
Sequence:CCGGTCATCGTCATTCCACTGATTGCTCGAGCAATCAGTGGAATGACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054021.1-1296s21c1
Sequence:CCGGCCAGTGGGTGATCACCATAATCTCGAGATTATGGTGATCACCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-1368s1c1
Sequence:CCGGCATGCACAAGACCATTAAGAACTCGAGTTCTTAATGGTCTTGTGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-589s1c1
Sequence:CCGGGTGGTGTCCTTCATCGTCATTCTCGAGAATGACGATGAAGGACACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-439s1c1
Sequence:CCGGCGCGGTTACCTGCTCCTCTATCTCGAGATAGAGGAGCAGGTAACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-1168s1c1
Sequence:CCGGCCCAGGTGCTACCAGTGCAAACTCGAGTTTGCACTGGTAGCACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-129s1c1
Sequence:CCGGCGCCTCTTTCGTCGGCAACATCTCGAGATGTTGCCGACGAAAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054021
GPR101 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 101
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054021.1-599s21c1
Sequence:CCGGTCATCGTCATTCCACTGATTGCTCGAGCAATCAGTGGAATGACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054021.1-1296s21c1
Sequence:CCGGCCAGTGGGTGATCACCATAATCTCGAGATTATGGTGATCACCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-1368s1c1
Sequence:CCGGCATGCACAAGACCATTAAGAACTCGAGTTCTTAATGGTCTTGTGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-589s1c1
Sequence:CCGGGTGGTGTCCTTCATCGTCATTCTCGAGAATGACGATGAAGGACACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-439s1c1
Sequence:CCGGCGCGGTTACCTGCTCCTCTATCTCGAGATAGAGGAGCAGGTAACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-1168s1c1
Sequence:CCGGCCCAGGTGCTACCAGTGCAAACTCGAGTTTGCACTGGTAGCACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054021.1-129s1c1
Sequence:CCGGCGCCTCTTTCGTCGGCAACATCTCGAGATGTTGCCGACGAAAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033360
GPR101 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 101
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-678s21c1
Sequence:CCGGGACCAACCGACGTAGTTATATCTCGAGATATAACTACGTCGGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-1543s21c1
Sequence:CCGGCAGTGGGTGATCACCATAATACTCGAGTATTATGGTGATCACCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033360.2-2867s21c1
Sequence:CCGGTTATCTCTGTACCGTAATAAACTCGAGTTTATTACGGTACAGAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-839s21c1
Sequence:CCGGTGGTATCCTTCCTCGTTATTCCTCGAGGAATAACGAGGAAGGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-571s21c1
Sequence:CCGGGTTAGCCTCACCCACTTATTTCTCGAGAAATAAGTGGGTGAGGCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033360
GPR101 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 101
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-678s21c1
Sequence:CCGGGACCAACCGACGTAGTTATATCTCGAGATATAACTACGTCGGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-1543s21c1
Sequence:CCGGCAGTGGGTGATCACCATAATACTCGAGTATTATGGTGATCACCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033360.2-2867s21c1
Sequence:CCGGTTATCTCTGTACCGTAATAAACTCGAGTTTATTACGGTACAGAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-839s21c1
Sequence:CCGGTGGTATCCTTCCTCGTTATTCCTCGAGGAATAACGAGGAAGGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-571s21c1
Sequence:CCGGGTTAGCCTCACCCACTTATTTCTCGAGAAATAAGTGGGTGAGGCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033360
GPR101 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 101
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-678s21c1
Sequence:CCGGGACCAACCGACGTAGTTATATCTCGAGATATAACTACGTCGGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-1543s21c1
Sequence:CCGGCAGTGGGTGATCACCATAATACTCGAGTATTATGGTGATCACCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033360.2-2867s21c1
Sequence:CCGGTTATCTCTGTACCGTAATAAACTCGAGTTTATTACGGTACAGAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-839s21c1
Sequence:CCGGTGGTATCCTTCCTCGTTATTCCTCGAGGAATAACGAGGAAGGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033360.2-571s21c1
Sequence:CCGGGTTAGCCTCACCCACTTATTTCTCGAGAAATAAGTGGGTGAGGCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks