EMAIL THIS PAGE TO A FRIEND

GPR107

G protein-coupled receptor 107

102 Gene Product Result for
Synonyms: GCDRP LUSTR1 RP11-88G17 bA138E2.2
Gene ID:
Mouse(277463) G protein-coupled receptor 107
Rat(311857) G protein-coupled receptor 107
sheep(101102382) G protein-coupled receptor 107
domestic guinea pig(100727119) G protein-coupled receptor 107
naked mole-rat(101698095) G protein-coupled receptor 107
Zebrafish(570589) G protein-coupled receptor 107
chicken(417186) G protein-coupled receptor 107
cow(617309) G protein-coupled receptor 107
domestic cat(101096770) G protein-coupled receptor 107
dog(480694) G protein-coupled receptor 107
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020960 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020960 Rosetta Predictions human pricing
NM_001107828 Rosetta Predictions rat pricing
NM_178760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354388 predicted 550
2 SASI_Hs02_00354389 predicted 1306
3 SASI_Hs01_00181271 predicted 1716
4 SASI_Hs01_00181273 predicted 1382
5 SASI_Hs01_00181274 predicted 367
6 SASI_Hs01_00181275 predicted 1431
7 SASI_Hs01_00181276 predicted 729
8 SASI_Hs01_00181277 predicted 549
9 SASI_Hs01_00181278 predicted 433
10 SASI_Hs01_00181280 predicted 484
11 SASI_Hs01_00181272 predicted 895
12 SASI_Hs01_00181279 predicted 1875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232675 predicted 600
2 SASI_Rn02_00232676 predicted 631
3 SASI_Rn02_00232677 predicted 860
4 SASI_Rn02_00232678 predicted 1598
5 SASI_Rn02_00232679 predicted 1208
6 SASI_Rn02_00232680 predicted 1162
7 SASI_Rn02_00232681 predicted 1228
8 SASI_Rn02_00232682 predicted 1118
9 SASI_Rn02_00232683 predicted 1716
10 SASI_Rn02_00232684 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121751 predicted 1691
2 SASI_Mm01_00121752 predicted 857
3 SASI_Mm01_00121753 predicted 1702
4 SASI_Mm01_00121754 predicted 554
5 SASI_Mm01_00121756 predicted 591
6 SASI_Mm01_00121757 predicted 327
7 SASI_Mm01_00121758 predicted 1109
8 SASI_Mm01_00121759 predicted 873
9 SASI_Mm01_00121760 predicted 284
10 SASI_Mm02_00349316 predicted 554
11 SASI_Mm01_00121755 predicted 1402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178760
VALIDATED
GPR107 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 107
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178760.2-1610s1c1
Sequence:CCGGGAATATGAAGAGGGTGAAGAACTCGAGTTCTTCACCCTCTTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_178760.2-1700s1c1
Sequence:CCGGGCTGTCAATGAAACTAGCTTACTCGAGTAAGCTAGTTTCATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_178760.2-735s1c1
Sequence:CCGGGCCTCATTCAGCCTGAATATTCTCGAGAATATTCAGGCTGAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-1000s21c1
Sequence:CCGGTGAAGGCTGGGCTGTTGTATACTCGAGTATACAACAGCCCAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-1513s21c1
Sequence:CCGGATTTCGCCCAGCTTCAGATAACTCGAGTTATCTGAAGCTGGGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_178760.3-320s1c1
Sequence:CCGGCTGGATGAAGATGTGAATTACCTCGAGGTAATTCACATCTTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178760.3-145s1c1
Sequence:CCGGCAAAGATGATGTGCGGCATAACTCGAGTTATGCCGCACATCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-278s21c1
Sequence:CCGGTTCAGTCTGGATCGGACTAAGCTCGAGCTTAGTCCGATCCAGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-1280s21c1
Sequence:CCGGGTGTGGTCAATCAGGCATTTACTCGAGTAAATGCCTGATTGACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-877s21c1
Sequence:CCGGTAAGAGAAGGAATGATGTATTCTCGAGAATACATCATTCCTTCTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178760
VALIDATED
GPR107 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 107
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178760.2-1610s1c1
Sequence:CCGGGAATATGAAGAGGGTGAAGAACTCGAGTTCTTCACCCTCTTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_178760.2-1700s1c1
Sequence:CCGGGCTGTCAATGAAACTAGCTTACTCGAGTAAGCTAGTTTCATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_178760.2-735s1c1
Sequence:CCGGGCCTCATTCAGCCTGAATATTCTCGAGAATATTCAGGCTGAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-1000s21c1
Sequence:CCGGTGAAGGCTGGGCTGTTGTATACTCGAGTATACAACAGCCCAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-1513s21c1
Sequence:CCGGATTTCGCCCAGCTTCAGATAACTCGAGTTATCTGAAGCTGGGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_178760.3-320s1c1
Sequence:CCGGCTGGATGAAGATGTGAATTACCTCGAGGTAATTCACATCTTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178760.3-145s1c1
Sequence:CCGGCAAAGATGATGTGCGGCATAACTCGAGTTATGCCGCACATCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-278s21c1
Sequence:CCGGTTCAGTCTGGATCGGACTAAGCTCGAGCTTAGTCCGATCCAGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-1280s21c1
Sequence:CCGGGTGTGGTCAATCAGGCATTTACTCGAGTAAATGCCTGATTGACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-877s21c1
Sequence:CCGGTAAGAGAAGGAATGATGTATTCTCGAGAATACATCATTCCTTCTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178760
VALIDATED
GPR107 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 107
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178760.2-1610s1c1
Sequence:CCGGGAATATGAAGAGGGTGAAGAACTCGAGTTCTTCACCCTCTTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_178760.2-1700s1c1
Sequence:CCGGGCTGTCAATGAAACTAGCTTACTCGAGTAAGCTAGTTTCATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_178760.2-735s1c1
Sequence:CCGGGCCTCATTCAGCCTGAATATTCTCGAGAATATTCAGGCTGAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-1000s21c1
Sequence:CCGGTGAAGGCTGGGCTGTTGTATACTCGAGTATACAACAGCCCAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-1513s21c1
Sequence:CCGGATTTCGCCCAGCTTCAGATAACTCGAGTTATCTGAAGCTGGGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_178760.3-320s1c1
Sequence:CCGGCTGGATGAAGATGTGAATTACCTCGAGGTAATTCACATCTTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178760.3-145s1c1
Sequence:CCGGCAAAGATGATGTGCGGCATAACTCGAGTTATGCCGCACATCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-278s21c1
Sequence:CCGGTTCAGTCTGGATCGGACTAAGCTCGAGCTTAGTCCGATCCAGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-1280s21c1
Sequence:CCGGGTGTGGTCAATCAGGCATTTACTCGAGTAAATGCCTGATTGACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178760.3-877s21c1
Sequence:CCGGTAAGAGAAGGAATGATGTATTCTCGAGAATACATCATTCCTTCTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020960
VALIDATED
GPR107 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 107
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-871s1c1
Sequence:CCGGCGACGGAATGATGTATTTAAACTCGAGTTTAAATACATCATTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-162s1c1
Sequence:CCGGGAGGCATAAAGTTCATCTGAACTCGAGTTCAGATGAACTTTATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-432s1c1
Sequence:CCGGCCAGTTACCAAAGATCATCTTCTCGAGAAGATGATCTTTGGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-286s1c1
Sequence:CCGGCGTACAAAGAATGATGGCTTTCTCGAGAAAGCCATCATTCTTTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-723s1c1
Sequence:CCGGGTTTACATTCAGCCTTGATATCTCGAGATATCAAGGCTGAATGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-2193s21c1
Sequence:CCGGTTCGGAGCTCTAAGGTGTATGCTCGAGCATACACCTTAGAGCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-938s21c1
Sequence:CCGGGTTTACATTCAGCCTTGATATCTCGAGATATCAAGGCTGAATGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-1597s21c1
Sequence:CCGGTATACTTCACTAGGATCATTGCTCGAGCAATGATCCTAGTGAAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-1261s21c1
Sequence:CCGGTCATCACCATTGCACTCATTGCTCGAGCAATGAGTGCAATGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-1086s21c1
Sequence:CCGGCGACGGAATGATGTATTTAAACTCGAGTTTAAATACATCATTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020960
VALIDATED
GPR107 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 107
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-871s1c1
Sequence:CCGGCGACGGAATGATGTATTTAAACTCGAGTTTAAATACATCATTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-162s1c1
Sequence:CCGGGAGGCATAAAGTTCATCTGAACTCGAGTTCAGATGAACTTTATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-432s1c1
Sequence:CCGGCCAGTTACCAAAGATCATCTTCTCGAGAAGATGATCTTTGGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-286s1c1
Sequence:CCGGCGTACAAAGAATGATGGCTTTCTCGAGAAAGCCATCATTCTTTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-723s1c1
Sequence:CCGGGTTTACATTCAGCCTTGATATCTCGAGATATCAAGGCTGAATGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-2193s21c1
Sequence:CCGGTTCGGAGCTCTAAGGTGTATGCTCGAGCATACACCTTAGAGCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-938s21c1
Sequence:CCGGGTTTACATTCAGCCTTGATATCTCGAGATATCAAGGCTGAATGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-1597s21c1
Sequence:CCGGTATACTTCACTAGGATCATTGCTCGAGCAATGATCCTAGTGAAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-1261s21c1
Sequence:CCGGTCATCACCATTGCACTCATTGCTCGAGCAATGAGTGCAATGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-1086s21c1
Sequence:CCGGCGACGGAATGATGTATTTAAACTCGAGTTTAAATACATCATTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020960
VALIDATED
GPR107 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 107
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-871s1c1
Sequence:CCGGCGACGGAATGATGTATTTAAACTCGAGTTTAAATACATCATTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-162s1c1
Sequence:CCGGGAGGCATAAAGTTCATCTGAACTCGAGTTCAGATGAACTTTATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-432s1c1
Sequence:CCGGCCAGTTACCAAAGATCATCTTCTCGAGAAGATGATCTTTGGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-286s1c1
Sequence:CCGGCGTACAAAGAATGATGGCTTTCTCGAGAAAGCCATCATTCTTTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020960.1-723s1c1
Sequence:CCGGGTTTACATTCAGCCTTGATATCTCGAGATATCAAGGCTGAATGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-2193s21c1
Sequence:CCGGTTCGGAGCTCTAAGGTGTATGCTCGAGCATACACCTTAGAGCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-938s21c1
Sequence:CCGGGTTTACATTCAGCCTTGATATCTCGAGATATCAAGGCTGAATGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-1597s21c1
Sequence:CCGGTATACTTCACTAGGATCATTGCTCGAGCAATGATCCTAGTGAAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-1261s21c1
Sequence:CCGGTCATCACCATTGCACTCATTGCTCGAGCAATGAGTGCAATGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020960.4-1086s21c1
Sequence:CCGGCGACGGAATGATGTATTTAAACTCGAGTTTAAATACATCATTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks