EMAIL THIS PAGE TO A FRIEND

GPR108

G protein-coupled receptor 108

150 Gene Product Result for
Synonyms: LUSTR2
UniProtKB ID: Q9NPR9, B9EJD7
Gene ID:
Mouse(78308) G protein-coupled receptor 108
Rat(316136) G protein-coupled receptor 108
domestic cat(101096953) G protein-coupled receptor 108
cow(507830) G protein-coupled receptor 108
dog(476727) G protein-coupled receptor 108
domestic guinea pig(100713774) G protein-coupled receptor 108
naked mole-rat(101726617) G protein-coupled receptor 108
sheep(101104824) G protein-coupled receptor 108
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080452 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080452 Rosetta Predictions human pricing
NM_020171 Rosetta Predictions human pricing
XM_290854 Rosetta Predictions human pricing
XM_933913 Rosetta Predictions human pricing
XM_933916 Rosetta Predictions human pricing
XM_933921 Rosetta Predictions human pricing
XM_933923 Rosetta Predictions human pricing
XM_933927 Rosetta Predictions human pricing
XM_933929 Rosetta Predictions human pricing
XM_933932 Rosetta Predictions human pricing
XM_933933 Rosetta Predictions human pricing
NM_199399 Rosetta Predictions rat pricing
NM_030084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314976 predicted 587
2 SASI_Hs02_00314977 predicted 893
3 SASI_Hs02_00314978 predicted 1728
4 SASI_Hs02_00314979 predicted 375
5 SASI_Hs02_00314980 predicted 593
6 SASI_Hs02_00314981 predicted 705
7 SASI_Hs02_00314982 predicted 944
8 SASI_Hs02_00314983 predicted 1359
9 SASI_Hs02_00314984 predicted 878
10 SASI_Hs02_00314985 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353082 predicted 1870
2 SASI_Hs02_00353083 predicted 1083
3 SASI_Hs02_00353084 predicted 1665
4 SASI_Hs02_00353085 predicted 1264
5 SASI_Hs02_00353086 predicted 1509
6 SASI_Hs02_00353087 predicted 1310
7 SASI_Hs02_00353088 predicted 1723
8 SASI_Hs02_00353089 predicted 1002
9 SASI_Hs02_00353090 predicted 1242
10 SASI_Hs02_00353091 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248049 predicted 587
2 SASI_Hs01_00248050 predicted 1725
3 SASI_Hs01_00248051 predicted 370
4 SASI_Hs01_00248052 predicted 326
5 SASI_Hs01_00248053 predicted 709
6 SASI_Hs01_00248054 predicted 950
7 SASI_Hs01_00248055 predicted 1358
8 SASI_Hs01_00248056 predicted 1524
9 SASI_Hs01_00248057 predicted 566
10 SASI_Hs01_00248058 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268350 predicted 1883
2 SASI_Hs01_00268351 predicted 1094
3 SASI_Hs01_00268352 predicted 1676
4 SASI_Hs01_00268353 predicted 1125
5 SASI_Hs01_00268354 predicted 1282
6 SASI_Hs01_00268355 predicted 1521
7 SASI_Hs01_00268356 predicted 1328
8 SASI_Hs01_00268357 predicted 1737
9 SASI_Hs01_00268358 predicted 1010
10 SASI_Hs01_00268359 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289820 predicted 1472
2 SASI_Hs01_00289821 predicted 1153
3 SASI_Hs01_00289822 predicted 1473
4 SASI_Hs01_00289823 predicted 1274
5 SASI_Hs01_00289824 predicted 1016
6 SASI_Hs01_00289825 predicted 930
7 SASI_Hs01_00289826 predicted 964
8 SASI_Hs01_00289827 predicted 1327
9 SASI_Hs01_00289828 predicted 1051
10 SASI_Hs01_00289829 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298097 predicted 413
2 SASI_Hs01_00298098 predicted 291
3 SASI_Hs01_00298099 predicted 340
4 SASI_Hs01_00298100 predicted 306
5 SASI_Hs01_00298101 predicted 337
6 SASI_Hs01_00298102 predicted 399
7 SASI_Hs01_00298103 predicted 201
8 SASI_Hs01_00298104 predicted 335
9 SASI_Hs01_00298105 predicted 343
10 SASI_Hs01_00298106 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270746 predicted 975
2 SASI_Hs01_00270747 predicted 214
3 SASI_Hs01_00270748 predicted 961
4 SASI_Hs01_00270749 predicted 771
5 SASI_Hs01_00270750 predicted 460
6 SASI_Hs01_00270751 predicted 376
7 SASI_Hs01_00270752 predicted 616
8 SASI_Hs01_00270753 predicted 415
9 SASI_Hs01_00270754 predicted 827
10 SASI_Hs01_00270755 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293058 predicted 818
2 SASI_Hs01_00293059 predicted 811
3 SASI_Hs01_00293060 predicted 443
4 SASI_Hs01_00293061 predicted 618
5 SASI_Hs01_00293062 predicted 314
6 SASI_Hs01_00293063 predicted 220
7 SASI_Hs01_00293064 predicted 471
8 SASI_Hs01_00293065 predicted 271
9 SASI_Hs01_00293066 predicted 679
10 SASI_Hs01_00293067 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278304 predicted 593
2 SASI_Hs01_00278305 predicted 371
3 SASI_Hs01_00278306 predicted 317
4 SASI_Hs01_00278307 predicted 1584
5 SASI_Hs01_00278308 predicted 593
6 SASI_Hs01_00278309 predicted 701
7 SASI_Hs01_00278310 predicted 943
8 SASI_Hs01_00278311 predicted 1357
9 SASI_Hs01_00278312 predicted 1518
10 SASI_Hs01_00278313 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297528 predicted 1570
2 SASI_Hs01_00297529 predicted 792
3 SASI_Hs01_00297530 predicted 1369
4 SASI_Hs01_00297531 predicted 810
5 SASI_Hs01_00297532 predicted 969
6 SASI_Hs01_00297533 predicted 1222
7 SASI_Hs01_00297534 predicted 1015
8 SASI_Hs01_00297535 predicted 1423
9 SASI_Hs01_00297536 predicted 703
10 SASI_Hs01_00297537 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272065 predicted 596
2 SASI_Hs01_00272066 predicted 1666
3 SASI_Hs01_00272067 predicted 377
4 SASI_Hs01_00272068 predicted 324
5 SASI_Hs01_00272069 predicted 709
6 SASI_Hs01_00272070 predicted 940
7 SASI_Hs01_00272071 predicted 1366
8 SASI_Hs01_00272072 predicted 878
9 SASI_Hs01_00272073 predicted 572
10 SASI_Hs01_00272074 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085016 predicted 552
2 SASI_Rn01_00085017 predicted 1240
3 SASI_Rn01_00085018 predicted 721
4 SASI_Rn01_00085019 predicted 511
5 SASI_Rn01_00085021 predicted 768
6 SASI_Rn01_00085022 predicted 784
7 SASI_Rn01_00085023 predicted 555
8 SASI_Rn01_00085024 predicted 411
9 SASI_Rn01_00085025 predicted 1441
10 SASI_Rn02_00270224 predicted 195
11 SASI_Rn01_00085020 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188919 predicted 265
2 SASI_Mm01_00188925 predicted 1206
3 SASI_Mm01_00188920 predicted 936
4 SASI_Mm01_00188921 predicted 342
5 SASI_Mm01_00188923 predicted 783
6 SASI_Mm01_00188924 predicted 310
7 SASI_Mm01_00188926 predicted 1463
8 SASI_Mm02_00336482 predicted 672
9 SASI_Mm01_00188927 predicted 1409
10 SASI_Mm01_00188928 predicted 1378
11 SASI_Mm01_00188922 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080452
GPR108 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 108
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080452.1-1734s21c1
Sequence:CCGGCCCTTCTTCCACAGCGTATGTCTCGAGACATACGCTGTGGAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-1371s21c1
Sequence:CCGGAGCTGTTCCGGCATTACTATGCTCGAGCATAGTAATGCCGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-573s21c1
Sequence:CCGGAGTCAACACCCGCAGTGATTCCTCGAGGAATCACTGCGGGTGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080452.1-1897s21c1
Sequence:CCGGTCCAGCTATGTGTACAATAATCTCGAGATTATTGTACACATAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-714s21c1
Sequence:CCGGACTTCCACAACTGCAACAATTCTCGAGAATTGTTGCAGTTGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-1114s21c1
Sequence:CCGGCAAGTACGTCCTGTCGGATAACTCGAGTTATCCGACAGGACGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-328s21c1
Sequence:CCGGCTCCTATTCAACCCGGGATTTCTCGAGAAATCCCGGGTTGAATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-441s21c1
Sequence:CCGGGAGAGCAGAAGACGTTGTTTACTCGAGTAAACAACGTCTTCTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080452
GPR108 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 108
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080452.1-1734s21c1
Sequence:CCGGCCCTTCTTCCACAGCGTATGTCTCGAGACATACGCTGTGGAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-1371s21c1
Sequence:CCGGAGCTGTTCCGGCATTACTATGCTCGAGCATAGTAATGCCGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-573s21c1
Sequence:CCGGAGTCAACACCCGCAGTGATTCCTCGAGGAATCACTGCGGGTGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080452.1-1897s21c1
Sequence:CCGGTCCAGCTATGTGTACAATAATCTCGAGATTATTGTACACATAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-714s21c1
Sequence:CCGGACTTCCACAACTGCAACAATTCTCGAGAATTGTTGCAGTTGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-1114s21c1
Sequence:CCGGCAAGTACGTCCTGTCGGATAACTCGAGTTATCCGACAGGACGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-328s21c1
Sequence:CCGGCTCCTATTCAACCCGGGATTTCTCGAGAAATCCCGGGTTGAATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-441s21c1
Sequence:CCGGGAGAGCAGAAGACGTTGTTTACTCGAGTAAACAACGTCTTCTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080452
GPR108 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 108
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080452.1-1734s21c1
Sequence:CCGGCCCTTCTTCCACAGCGTATGTCTCGAGACATACGCTGTGGAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-1371s21c1
Sequence:CCGGAGCTGTTCCGGCATTACTATGCTCGAGCATAGTAATGCCGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-573s21c1
Sequence:CCGGAGTCAACACCCGCAGTGATTCCTCGAGGAATCACTGCGGGTGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080452.1-1897s21c1
Sequence:CCGGTCCAGCTATGTGTACAATAATCTCGAGATTATTGTACACATAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-714s21c1
Sequence:CCGGACTTCCACAACTGCAACAATTCTCGAGAATTGTTGCAGTTGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-1114s21c1
Sequence:CCGGCAAGTACGTCCTGTCGGATAACTCGAGTTATCCGACAGGACGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-328s21c1
Sequence:CCGGCTCCTATTCAACCCGGGATTTCTCGAGAAATCCCGGGTTGAATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080452.1-441s21c1
Sequence:CCGGGAGAGCAGAAGACGTTGTTTACTCGAGTAAACAACGTCTTCTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030084
VALIDATED
GPR108 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 108
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-923s21c1
Sequence:CCGGCGTGCTCTGCAAGAACACATACTCGAGTATGTGTTCTTGCAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-152s21c1
Sequence:CCGGCCAACTGAACAGCTTCGGATTCTCGAGAATCCGAAGCTGTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-1061s21c1
Sequence:CCGGCCTCGCGGTCATGCACTATATCTCGAGATATAGTGCATGACCGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-1884s21c1
Sequence:CCGGTCAGCCTCTTGTGGTACAATACTCGAGTATTGTACCACAAGAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-1949s1c1
Sequence:CCGGGCTGCATTTATGATCTCAGTTCTCGAGAACTGAGATCATAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-152s1c1
Sequence:CCGGCCAACTGAACAGCTTCGGATTCTCGAGAATCCGAAGCTGTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-1211s1c1
Sequence:CCGGCCTGGCTAATGTAGCATACATCTCGAGATGTATGCTACATTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030084.2-923s1c1
Sequence:CCGGCGTGCTCTGCAAGAACACATACTCGAGTATGTGTTCTTGCAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-674s1c1
Sequence:CCGGCCACCTCAATGACTCCTACAACTCGAGTTGTAGGAGTCATTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030084
VALIDATED
GPR108 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 108
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-923s21c1
Sequence:CCGGCGTGCTCTGCAAGAACACATACTCGAGTATGTGTTCTTGCAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-152s21c1
Sequence:CCGGCCAACTGAACAGCTTCGGATTCTCGAGAATCCGAAGCTGTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-1061s21c1
Sequence:CCGGCCTCGCGGTCATGCACTATATCTCGAGATATAGTGCATGACCGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-1884s21c1
Sequence:CCGGTCAGCCTCTTGTGGTACAATACTCGAGTATTGTACCACAAGAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-1949s1c1
Sequence:CCGGGCTGCATTTATGATCTCAGTTCTCGAGAACTGAGATCATAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-152s1c1
Sequence:CCGGCCAACTGAACAGCTTCGGATTCTCGAGAATCCGAAGCTGTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-1211s1c1
Sequence:CCGGCCTGGCTAATGTAGCATACATCTCGAGATGTATGCTACATTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030084.2-923s1c1
Sequence:CCGGCGTGCTCTGCAAGAACACATACTCGAGTATGTGTTCTTGCAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-674s1c1
Sequence:CCGGCCACCTCAATGACTCCTACAACTCGAGTTGTAGGAGTCATTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030084
VALIDATED
GPR108 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 108
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-923s21c1
Sequence:CCGGCGTGCTCTGCAAGAACACATACTCGAGTATGTGTTCTTGCAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-152s21c1
Sequence:CCGGCCAACTGAACAGCTTCGGATTCTCGAGAATCCGAAGCTGTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-1061s21c1
Sequence:CCGGCCTCGCGGTCATGCACTATATCTCGAGATATAGTGCATGACCGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030084.3-1884s21c1
Sequence:CCGGTCAGCCTCTTGTGGTACAATACTCGAGTATTGTACCACAAGAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-1949s1c1
Sequence:CCGGGCTGCATTTATGATCTCAGTTCTCGAGAACTGAGATCATAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-152s1c1
Sequence:CCGGCCAACTGAACAGCTTCGGATTCTCGAGAATCCGAAGCTGTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-1211s1c1
Sequence:CCGGCCTGGCTAATGTAGCATACATCTCGAGATGTATGCTACATTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030084.2-923s1c1
Sequence:CCGGCGTGCTCTGCAAGAACACATACTCGAGTATGTGTTCTTGCAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030084.2-674s1c1
Sequence:CCGGCCACCTCAATGACTCCTACAACTCGAGTTGTAGGAGTCATTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks