EMAIL THIS PAGE TO A FRIEND

GPR110

G protein-coupled receptor 110

118 Gene Product Result for
Synonyms: KPG_012 PGR19 hGPCR36
Gene ID:
Mouse(77596) G protein-coupled receptor 110
Rat(301266) G protein-coupled receptor 110
sheep(101121464) G protein-coupled receptor 110
domestic guinea pig(100727513) G protein-coupled receptor 110
naked mole-rat(101714036) G protein-coupled receptor 110
dog(474927) G protein-coupled receptor 110
Horse(100068434) G protein-coupled receptor 110
cow(512637) G protein-coupled receptor 110
domestic cat(101101565) G protein-coupled receptor 110
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153840 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062271 MISSION® esiRNA esiRNA human GPR110 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025048 Rosetta Predictions human pricing
NM_153840 Rosetta Predictions human pricing
NM_001106894 Rosetta Predictions rat pricing
NM_133776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243010 predicted 474
2 SASI_Hs01_00243011 predicted 435
3 SASI_Hs01_00243012 predicted 426
4 SASI_Hs01_00243013 predicted 589
5 SASI_Hs01_00243014 predicted 294
6 SASI_Hs01_00243015 predicted 424
7 SASI_Hs01_00243016 predicted 317
8 SASI_Hs01_00243017 predicted 410
9 SASI_Hs01_00243018 predicted 581
10 SASI_Hs02_00357699 predicted 471
11 SASI_Hs01_00243019 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151188 predicted 470
2 SASI_Hs01_00151189 predicted 430
3 SASI_Hs01_00151190 predicted 427
4 SASI_Hs01_00151191 predicted 591
5 SASI_Hs01_00151192 predicted 292
6 SASI_Hs01_00151193 predicted 431
7 SASI_Hs01_00151194 predicted 311
8 SASI_Hs01_00151195 predicted 411
9 SASI_Hs01_00151196 predicted 585
10 SASI_Hs02_00367537 predicted 476
11 SASI_Hs01_00151197 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223456 predicted 1599
2 SASI_Rn02_00223457 predicted 2109
3 SASI_Rn02_00223458 predicted 2833
4 SASI_Rn02_00223459 predicted 2341
5 SASI_Rn02_00223460 predicted 2310
6 SASI_Rn02_00223461 predicted 2766
7 SASI_Rn02_00223462 predicted 2652
8 SASI_Rn02_00223463 predicted 2426
9 SASI_Rn02_00223464 predicted 2450
10 SASI_Rn02_00223465 predicted 2061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184620 predicted 2508
2 SASI_Mm02_00338789 predicted 2918
3 SASI_Mm01_00184621 predicted 1456
4 SASI_Mm01_00184622 predicted 990
5 SASI_Mm01_00184624 predicted 2468
6 SASI_Mm01_00184625 predicted 1524
7 SASI_Mm01_00184626 predicted 1838
8 SASI_Mm01_00184629 predicted 2221
9 SASI_Mm02_00338790 predicted 2352
10 SASI_Mm02_00338791 predicted 2163
11 SASI_Mm01_00184623 predicted 2574
12 SASI_Mm01_00184627 predicted 2975
13 SASI_Mm01_00184628 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133776
GPR110 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 110
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-1107s1c1
Sequence:CCGGCGGGTCTGAGAACGATGAATACTCGAGTATTCATCGTTCTCAGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-2931s1c1
Sequence:CCGGGCCGAAATGCTTAAGGACATTCTCGAGAATGTCCTTAAGCATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-838s1c1
Sequence:CCGGGCCCACTACACAGTTGGAATTCTCGAGAATTCCAACTGTGTAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-2439s1c1
Sequence:CCGGCCCTCTCCTTATATCCATCATCTCGAGATGATGGATATAAGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-2221s1c1
Sequence:CCGGGCTGATGTTTGGTTTATCATTCTCGAGAATGATAAACCAAACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133776
GPR110 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 110
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-1107s1c1
Sequence:CCGGCGGGTCTGAGAACGATGAATACTCGAGTATTCATCGTTCTCAGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-2931s1c1
Sequence:CCGGGCCGAAATGCTTAAGGACATTCTCGAGAATGTCCTTAAGCATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-838s1c1
Sequence:CCGGGCCCACTACACAGTTGGAATTCTCGAGAATTCCAACTGTGTAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-2439s1c1
Sequence:CCGGCCCTCTCCTTATATCCATCATCTCGAGATGATGGATATAAGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-2221s1c1
Sequence:CCGGGCTGATGTTTGGTTTATCATTCTCGAGAATGATAAACCAAACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133776
GPR110 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 110
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-1107s1c1
Sequence:CCGGCGGGTCTGAGAACGATGAATACTCGAGTATTCATCGTTCTCAGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-2931s1c1
Sequence:CCGGGCCGAAATGCTTAAGGACATTCTCGAGAATGTCCTTAAGCATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-838s1c1
Sequence:CCGGGCCCACTACACAGTTGGAATTCTCGAGAATTCCAACTGTGTAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-2439s1c1
Sequence:CCGGCCCTCTCCTTATATCCATCATCTCGAGATGATGGATATAAGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133776.1-2221s1c1
Sequence:CCGGGCTGATGTTTGGTTTATCATTCTCGAGAATGATAAACCAAACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153840
GPR110 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 110
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-1944s1c1
Sequence:CCGGGCGACAACTTCTGTTCAACAACTCGAGTTGTTGAACAGAAGTTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-1265s1c1
Sequence:CCGGCCTCTCACACACGTCGTATTTCTCGAGAAATACGACGTGTGTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-1537s1c1
Sequence:CCGGCCTCTCATTATATCTGTCATTCTCGAGAATGACAGATATAATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-611s1c1
Sequence:CCGGGCTCACGGTTACTAGAGACATCTCGAGATGTCTCTAGTAACCGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-174s1c1
Sequence:CCGGCCAGTGTAATGACATTGTCTTCTCGAGAAGACAATGTCATTACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153840.2-429s21c1
Sequence:CCGGTATGGTCACATGGGCTAATTACTCGAGTAATTAGCCCATGTGACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153840.2-1709s21c1
Sequence:CCGGCCTGTGATATCCACGGTTATTCTCGAGAATAACCGTGGATATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153840.2-322s21c1
Sequence:CCGGTCTAGGCCCAGTCGAAGAATACTCGAGTATTCTTCGACTGGGCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153840
GPR110 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 110
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-1944s1c1
Sequence:CCGGGCGACAACTTCTGTTCAACAACTCGAGTTGTTGAACAGAAGTTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-1265s1c1
Sequence:CCGGCCTCTCACACACGTCGTATTTCTCGAGAAATACGACGTGTGTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-1537s1c1
Sequence:CCGGCCTCTCATTATATCTGTCATTCTCGAGAATGACAGATATAATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-611s1c1
Sequence:CCGGGCTCACGGTTACTAGAGACATCTCGAGATGTCTCTAGTAACCGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-174s1c1
Sequence:CCGGCCAGTGTAATGACATTGTCTTCTCGAGAAGACAATGTCATTACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153840.2-429s21c1
Sequence:CCGGTATGGTCACATGGGCTAATTACTCGAGTAATTAGCCCATGTGACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153840.2-1709s21c1
Sequence:CCGGCCTGTGATATCCACGGTTATTCTCGAGAATAACCGTGGATATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153840.2-322s21c1
Sequence:CCGGTCTAGGCCCAGTCGAAGAATACTCGAGTATTCTTCGACTGGGCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153840
GPR110 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 110
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-1944s1c1
Sequence:CCGGGCGACAACTTCTGTTCAACAACTCGAGTTGTTGAACAGAAGTTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-1265s1c1
Sequence:CCGGCCTCTCACACACGTCGTATTTCTCGAGAAATACGACGTGTGTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-1537s1c1
Sequence:CCGGCCTCTCATTATATCTGTCATTCTCGAGAATGACAGATATAATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-611s1c1
Sequence:CCGGGCTCACGGTTACTAGAGACATCTCGAGATGTCTCTAGTAACCGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153840.1-174s1c1
Sequence:CCGGCCAGTGTAATGACATTGTCTTCTCGAGAAGACAATGTCATTACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153840.2-429s21c1
Sequence:CCGGTATGGTCACATGGGCTAATTACTCGAGTAATTAGCCCATGTGACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153840.2-1709s21c1
Sequence:CCGGCCTGTGATATCCACGGTTATTCTCGAGAATAACCGTGGATATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153840.2-322s21c1
Sequence:CCGGTCTAGGCCCAGTCGAAGAATACTCGAGTATTCTTCGACTGGGCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks