EMAIL THIS PAGE TO A FRIEND

GPR111

G protein-coupled receptor 111

117 Gene Product Result for
Synonyms: PGR20 hGPCR35
UniProtKB ID: Q8IZF7, Q2PNZ1, Q86SL6, Q8NGU5, Q8TDT5
Gene ID:
Mouse(435529) G protein-coupled receptor 111
Rat(301269) G protein-coupled receptor 111
dog(609995) G protein-coupled receptor 111
cow(539131) G protein-coupled receptor 111
Horse(100068533) G protein-coupled receptor 111
domestic cat(101091871) G protein-coupled receptor 111
domestic guinea pig(100731117) G protein-coupled receptor 111
naked mole-rat(101700993) G protein-coupled receptor 111
sheep(101121719) G protein-coupled receptor 111
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153839 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU151141 MISSION® esiRNA esiRNA targeting mouse Gpr111 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153839 Rosetta Predictions human pricing
XM_001069077 Rosetta Predictions rat pricing
XM_236958 Rosetta Predictions rat pricing
NM_001033493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043310 predicted 852
2 SASI_Hs01_00043313 predicted 697
3 SASI_Hs01_00043315 predicted 1147
4 SASI_Hs01_00043316 predicted 713
5 SASI_Hs01_00043318 predicted 1974
6 SASI_Hs02_00367532 predicted 1320
7 SASI_Hs02_00367533 predicted 1587
8 SASI_Hs02_00367534 predicted 1382
9 SASI_Hs02_00367535 predicted 1354
10 SASI_Hs02_00367536 predicted 1915
11 SASI_Hs01_00043311 predicted 2272
12 SASI_Hs01_00043312 predicted 1335
13 SASI_Hs01_00043314 predicted 2243
14 SASI_Hs01_00043317 predicted 1551
15 SASI_Hs01_00043319 predicted 2166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326830 predicted 1283
2 SASI_Rn02_00326831 predicted 514
3 SASI_Rn02_00326832 predicted 370
4 SASI_Rn02_00326833 predicted 701
5 SASI_Rn02_00326834 predicted 1269
6 SASI_Rn02_00326835 predicted 1838
7 SASI_Rn02_00326836 predicted 239
8 SASI_Rn02_00326837 predicted 1316
9 SASI_Rn02_00326838 predicted 414
10 SASI_Rn02_00326839 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390534 predicted 521
2 SASI_Rn02_00390535 predicted 372
3 SASI_Rn02_00390536 predicted 1996
4 SASI_Rn02_00390537 predicted 698
5 SASI_Rn02_00390538 predicted 1263
6 SASI_Rn02_00390539 predicted 1835
7 SASI_Rn02_00390540 predicted 237
8 SASI_Rn02_00390541 predicted 1313
9 SASI_Rn02_00390542 predicted 408
10 SASI_Rn02_00390543 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288861 predicted 559
2 SASI_Mm01_00088166 predicted 1425
3 SASI_Mm02_00288862 predicted 599
4 SASI_Mm01_00088170 predicted 1494
5 SASI_Mm01_00088171 predicted 2226
6 SASI_Mm01_00088173 predicted 880
7 SASI_Mm02_00288863 predicted 490
8 SASI_Mm01_00088174 predicted 842
9 SASI_Mm02_00288864 predicted 1028
10 SASI_Mm02_00288865 predicted 736
11 SASI_Mm01_00088167 predicted 1522
12 SASI_Mm01_00088168 predicted 776
13 SASI_Mm01_00088169 predicted 1723
14 SASI_Mm01_00088172 predicted 2188
15 SASI_Mm01_00088175 predicted 2004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153839
GPR111 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 111
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-1905s21c1
Sequence:CCGGTTTGGCCATCGTGGTAGTAAACTCGAGTTTACTACCACGATGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-1521s21c1
Sequence:CCGGACGCCATGTGTGCATTGTTAACTCGAGTTAACAATGCACACATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-1094s21c1
Sequence:CCGGGCATTGCATTTCCAACTATTGCTCGAGCAATAGTTGGAAATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-694s21c1
Sequence:CCGGCCAGGAAACATTGCCGTAATTCTCGAGAATTACGGCAATGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-87s1c1
Sequence:CCGGCCAGCCTGTGATTTGTAGCAACTCGAGTTGCTACAAATCACAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-881s1c1
Sequence:CCGGGCACCACCATATCTGGAGATACTCGAGTATCTCCAGATATGGTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-782s1c1
Sequence:CCGGGCAGCTATATCCTGCTACATTCTCGAGAATGTAGCAGGATATAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-634s1c1
Sequence:CCGGGCCGTAATTGTGCAGCTCTTACTCGAGTAAGAGCTGCACAATTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-1315s1c1
Sequence:CCGGCACATCTTAGAGAGTCTGATTCTCGAGAATCAGACTCTCTAAGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153839
GPR111 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 111
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-1905s21c1
Sequence:CCGGTTTGGCCATCGTGGTAGTAAACTCGAGTTTACTACCACGATGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-1521s21c1
Sequence:CCGGACGCCATGTGTGCATTGTTAACTCGAGTTAACAATGCACACATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-1094s21c1
Sequence:CCGGGCATTGCATTTCCAACTATTGCTCGAGCAATAGTTGGAAATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-694s21c1
Sequence:CCGGCCAGGAAACATTGCCGTAATTCTCGAGAATTACGGCAATGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-87s1c1
Sequence:CCGGCCAGCCTGTGATTTGTAGCAACTCGAGTTGCTACAAATCACAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-881s1c1
Sequence:CCGGGCACCACCATATCTGGAGATACTCGAGTATCTCCAGATATGGTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-782s1c1
Sequence:CCGGGCAGCTATATCCTGCTACATTCTCGAGAATGTAGCAGGATATAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-634s1c1
Sequence:CCGGGCCGTAATTGTGCAGCTCTTACTCGAGTAAGAGCTGCACAATTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-1315s1c1
Sequence:CCGGCACATCTTAGAGAGTCTGATTCTCGAGAATCAGACTCTCTAAGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153839
GPR111 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 111
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-1905s21c1
Sequence:CCGGTTTGGCCATCGTGGTAGTAAACTCGAGTTTACTACCACGATGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-1521s21c1
Sequence:CCGGACGCCATGTGTGCATTGTTAACTCGAGTTAACAATGCACACATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-1094s21c1
Sequence:CCGGGCATTGCATTTCCAACTATTGCTCGAGCAATAGTTGGAAATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153839.5-694s21c1
Sequence:CCGGCCAGGAAACATTGCCGTAATTCTCGAGAATTACGGCAATGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-87s1c1
Sequence:CCGGCCAGCCTGTGATTTGTAGCAACTCGAGTTGCTACAAATCACAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-881s1c1
Sequence:CCGGGCACCACCATATCTGGAGATACTCGAGTATCTCCAGATATGGTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-782s1c1
Sequence:CCGGGCAGCTATATCCTGCTACATTCTCGAGAATGTAGCAGGATATAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-634s1c1
Sequence:CCGGGCCGTAATTGTGCAGCTCTTACTCGAGTAAGAGCTGCACAATTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153839.1-1315s1c1
Sequence:CCGGCACATCTTAGAGAGTCTGATTCTCGAGAATCAGACTCTCTAAGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033493
GPR111 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 111
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-905s21c1
Sequence:GTACCGGCATTTGCAAGCAAGCTATTTACTCGAGTAAATAGCTTGCTTGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033493.2-3096s21c1
Sequence:CCGGACTACACCATAGCTATTATATCTCGAGATATAATAGCTATGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1353s21c1
Sequence:CCGGTTGCCGTTGTCGGCCGAATAACTCGAGTTATTCGGCCGACAACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1012s21c1
Sequence:CCGGACGTTCTCAATGCGAATTAATCTCGAGATTAATTCGCATTGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-335s21c1
Sequence:CCGGTAGAATCCTGTAGGATATTATCTCGAGATAATATCCTACAGGATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1803s21c1
Sequence:CCGGCCCTTTGGTCATCGCCATTATCTCGAGATAATGGCGATGACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-557s21c1
Sequence:CCGGAGGAGGATAAGGAACTATATTCTCGAGAATATAGTTCCTTATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033493.2-2443s21c1
Sequence:CCGGTAGATACTAAAGACCATAAACCTCGAGGTTTATGGTCTTTAGTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-929s21c1
Sequence:CCGGAGGAACATCTCATCAACATATCTCGAGATATGTTGATGAGATGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1303s21c1
Sequence:CCGGTGGGACTGGAGGGCTTGTAAACTCGAGTTTACAAGCCCTCCAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033493
GPR111 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 111
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-905s21c1
Sequence:GTACCGGCATTTGCAAGCAAGCTATTTACTCGAGTAAATAGCTTGCTTGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033493.2-3096s21c1
Sequence:CCGGACTACACCATAGCTATTATATCTCGAGATATAATAGCTATGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1353s21c1
Sequence:CCGGTTGCCGTTGTCGGCCGAATAACTCGAGTTATTCGGCCGACAACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1012s21c1
Sequence:CCGGACGTTCTCAATGCGAATTAATCTCGAGATTAATTCGCATTGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-335s21c1
Sequence:CCGGTAGAATCCTGTAGGATATTATCTCGAGATAATATCCTACAGGATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1803s21c1
Sequence:CCGGCCCTTTGGTCATCGCCATTATCTCGAGATAATGGCGATGACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-557s21c1
Sequence:CCGGAGGAGGATAAGGAACTATATTCTCGAGAATATAGTTCCTTATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033493.2-2443s21c1
Sequence:CCGGTAGATACTAAAGACCATAAACCTCGAGGTTTATGGTCTTTAGTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-929s21c1
Sequence:CCGGAGGAACATCTCATCAACATATCTCGAGATATGTTGATGAGATGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1303s21c1
Sequence:CCGGTGGGACTGGAGGGCTTGTAAACTCGAGTTTACAAGCCCTCCAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033493
GPR111 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 111
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-905s21c1
Sequence:GTACCGGCATTTGCAAGCAAGCTATTTACTCGAGTAAATAGCTTGCTTGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033493.2-3096s21c1
Sequence:CCGGACTACACCATAGCTATTATATCTCGAGATATAATAGCTATGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1353s21c1
Sequence:CCGGTTGCCGTTGTCGGCCGAATAACTCGAGTTATTCGGCCGACAACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1012s21c1
Sequence:CCGGACGTTCTCAATGCGAATTAATCTCGAGATTAATTCGCATTGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-335s21c1
Sequence:CCGGTAGAATCCTGTAGGATATTATCTCGAGATAATATCCTACAGGATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1803s21c1
Sequence:CCGGCCCTTTGGTCATCGCCATTATCTCGAGATAATGGCGATGACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-557s21c1
Sequence:CCGGAGGAGGATAAGGAACTATATTCTCGAGAATATAGTTCCTTATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033493.2-2443s21c1
Sequence:CCGGTAGATACTAAAGACCATAAACCTCGAGGTTTATGGTCTTTAGTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-929s21c1
Sequence:CCGGAGGAACATCTCATCAACATATCTCGAGATATGTTGATGAGATGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033493.2-1303s21c1
Sequence:CCGGTGGGACTGGAGGGCTTGTAAACTCGAGTTTACAAGCCCTCCAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks