EMAIL THIS PAGE TO A FRIEND

GPR112

G protein-coupled receptor 112

56 Gene Product Result for
Synonyms: PGR17 RP1-299I16
UniProtKB ID: Q8IZF6, A2A2J1, A2A2J2, Q5EGP2, Q86SM6
Gene ID:
Human(139378) Summary: This gene encodes a G-protein coupled receptor belonging to a large family of diverse integral membrane proteins that participate in various physiological functions. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The ligand for this family member is unknown, and it is therefore an orphan receptor. This receptor is known to be expressed in normal enterochromaffin cells and in gastrointestinal neuroendocrine carcinoma cells, and it is therefore considered to be a novel biomarker or target for immunotherapy. [provided by RefSeq, May 2010]
Mouse(236798) G protein-coupled receptor 112
Rat(688451) G protein-coupled receptor 112
domestic guinea pig(100719576) G protein-coupled receptor 112
naked mole-rat(101715173) G protein-coupled receptor 112
chicken(422244) G protein-coupled receptor 112
cow(787088) G protein-coupled receptor 112
Horse(100056865) G protein-coupled receptor 112
dog(492163) G protein-coupled receptor 112
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153834 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001110790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001110790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001110790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153834 Rosetta Predictions human pricing
XM_001066996 Rosetta Predictions rat pricing
NM_001033327 Rosetta Predictions mouse pricing
NM_001110790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367521 predicted 7696
2 SASI_Hs01_00058761 predicted 3561
3 SASI_Hs01_00058762 predicted 8506
4 SASI_Hs01_00058763 predicted 8872
5 SASI_Hs01_00058764 predicted 8648
6 SASI_Hs01_00058765 predicted 4771
7 SASI_Hs01_00058766 predicted 3794
8 SASI_Hs01_00058767 predicted 6385
9 SASI_Hs01_00058769 predicted 7071
10 SASI_Hs01_00058770 predicted 6474
11 SASI_Hs01_00058768 predicted 7379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319513 predicted 412
2 SASI_Rn02_00319514 predicted 409
3 SASI_Rn02_00319515 predicted 489
4 SASI_Rn02_00319516 predicted 374
5 SASI_Rn02_00319517 predicted 465
6 SASI_Rn02_00319518 predicted 371
7 SASI_Rn02_00319519 predicted 288
8 SASI_Rn02_00319520 predicted 399
9 SASI_Rn02_00319521 predicted 368
10 SASI_Rn02_00319522 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054846 predicted 704
2 SASI_Mm01_00054847 predicted 777
3 SASI_Mm01_00054848 predicted 424
4 SASI_Mm01_00054849 predicted 808
5 SASI_Mm01_00054850 predicted 643
6 SASI_Mm01_00054851 predicted 429
7 SASI_Mm01_00054852 predicted 414
8 SASI_Mm01_00054853 predicted 411
9 SASI_Mm01_00054854 predicted 717
10 SASI_Mm01_00054855 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305728 predicted 747
2 SASI_Mm02_00305729 predicted 697
3 SASI_Mm02_00305730 predicted 418
4 SASI_Mm02_00305731 predicted 798
5 SASI_Mm02_00305732 predicted 636
6 SASI_Mm02_00305733 predicted 428
7 SASI_Mm02_00305734 predicted 415
8 SASI_Mm02_00305735 predicted 796
9 SASI_Mm02_00305736 predicted 715
10 SASI_Mm02_00305737 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153834
GPR112 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 112
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-4801s1c1
Sequence:CCGGGCTGGGATAGTGACTCCATTTCTCGAGAAATGGAGTCACTATCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-102s1c1
Sequence:CCGGGCAGCTAATACTATACAGATTCTCGAGAATCTGTATAGTATTAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-5713s1c1
Sequence:CCGGGCTGACGTTAAGCACACATTTCTCGAGAAATGTGTGCTTAACGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-1136s1c1
Sequence:CCGGCCGGAACTGTACCTTGGTTTACTCGAGTAAACCAAGGTACAGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-6742s1c1
Sequence:CCGGCCTGACAAGATTGTGGATCTTCTCGAGAAGATCCACAATCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153834.3-670s21c1
Sequence:CCGGGATGGTGTGAAGGGCAAATTACTCGAGTAATTTGCCCTTCACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153834.3-7381s21c1
Sequence:CCGGCAAGATCAATTGACGTTATTACTCGAGTAATAACGTCAATTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153834.3-4803s21c1
Sequence:CCGGGGCAACGTCCACTCCTATTTACTCGAGTAAATAGGAGTGGACGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153834
GPR112 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 112
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-4801s1c1
Sequence:CCGGGCTGGGATAGTGACTCCATTTCTCGAGAAATGGAGTCACTATCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-102s1c1
Sequence:CCGGGCAGCTAATACTATACAGATTCTCGAGAATCTGTATAGTATTAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-5713s1c1
Sequence:CCGGGCTGACGTTAAGCACACATTTCTCGAGAAATGTGTGCTTAACGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-1136s1c1
Sequence:CCGGCCGGAACTGTACCTTGGTTTACTCGAGTAAACCAAGGTACAGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-6742s1c1
Sequence:CCGGCCTGACAAGATTGTGGATCTTCTCGAGAAGATCCACAATCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153834.3-670s21c1
Sequence:CCGGGATGGTGTGAAGGGCAAATTACTCGAGTAATTTGCCCTTCACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153834.3-7381s21c1
Sequence:CCGGCAAGATCAATTGACGTTATTACTCGAGTAATAACGTCAATTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153834.3-4803s21c1
Sequence:CCGGGGCAACGTCCACTCCTATTTACTCGAGTAAATAGGAGTGGACGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153834
GPR112 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 112
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-4801s1c1
Sequence:CCGGGCTGGGATAGTGACTCCATTTCTCGAGAAATGGAGTCACTATCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-102s1c1
Sequence:CCGGGCAGCTAATACTATACAGATTCTCGAGAATCTGTATAGTATTAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-5713s1c1
Sequence:CCGGGCTGACGTTAAGCACACATTTCTCGAGAAATGTGTGCTTAACGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-1136s1c1
Sequence:CCGGCCGGAACTGTACCTTGGTTTACTCGAGTAAACCAAGGTACAGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153834.1-6742s1c1
Sequence:CCGGCCTGACAAGATTGTGGATCTTCTCGAGAAGATCCACAATCTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153834.3-670s21c1
Sequence:CCGGGATGGTGTGAAGGGCAAATTACTCGAGTAATTTGCCCTTCACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153834.3-7381s21c1
Sequence:CCGGCAAGATCAATTGACGTTATTACTCGAGTAATAACGTCAATTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153834.3-4803s21c1
Sequence:CCGGGGCAACGTCCACTCCTATTTACTCGAGTAAATAGGAGTGGACGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033327
GPR112 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 112
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-2213s21c1
Sequence:GTACCGGTCTAAACTCACCACCTTATTACTCGAGTAATAAGGTGGTGAGTTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-8063s21c1
Sequence:CCGGGCAGTAAATGAACGGATATTACTCGAGTAATATCCGTTCATTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-5912s21c1
Sequence:CCGGGACTCTCGGGCATCCATATTTCTCGAGAAATATGGATGCCCGAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-3962s21c1
Sequence:CCGGTTGTCCTCAAGCACCATAATACTCGAGTATTATGGTGCTTGAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-1687s21c1
Sequence:CCGGGAGTACACATCTAACCATAATCTCGAGATTATGGTTAGATGTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033327
GPR112 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 112
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-2213s21c1
Sequence:GTACCGGTCTAAACTCACCACCTTATTACTCGAGTAATAAGGTGGTGAGTTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-8063s21c1
Sequence:CCGGGCAGTAAATGAACGGATATTACTCGAGTAATATCCGTTCATTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-5912s21c1
Sequence:CCGGGACTCTCGGGCATCCATATTTCTCGAGAAATATGGATGCCCGAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-3962s21c1
Sequence:CCGGTTGTCCTCAAGCACCATAATACTCGAGTATTATGGTGCTTGAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-1687s21c1
Sequence:CCGGGAGTACACATCTAACCATAATCTCGAGATTATGGTTAGATGTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033327
GPR112 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 112
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-2213s21c1
Sequence:GTACCGGTCTAAACTCACCACCTTATTACTCGAGTAATAAGGTGGTGAGTTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-8063s21c1
Sequence:CCGGGCAGTAAATGAACGGATATTACTCGAGTAATATCCGTTCATTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-5912s21c1
Sequence:CCGGGACTCTCGGGCATCCATATTTCTCGAGAAATATGGATGCCCGAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-3962s21c1
Sequence:CCGGTTGTCCTCAAGCACCATAATACTCGAGTATTATGGTGCTTGAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033327.2-1687s21c1
Sequence:CCGGGAGTACACATCTAACCATAATCTCGAGATTATGGTTAGATGTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110790
GPR112 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 112
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-642s21c1
Sequence:CCGGTGGATAAATGTTAGGCATAAACTCGAGTTTATGCCTAACATTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-721s21c1
Sequence:CCGGCAACAACTTTCAAATCTATAGCTCGAGCTATAGATTTGAAAGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-886s21c1
Sequence:CCGGCTCAGAAACAAAGATCATTTCCTCGAGGAAATGATCTTTGTTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-417s21c1
Sequence:CCGGCTCAAAGGCACAATCAGTTTGCTCGAGCAAACTGATTGTGCCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-529s21c1
Sequence:CCGGCATTGCAAGGGTTCCTCATTTCTCGAGAAATGAGGAACCCTTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110790
GPR112 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 112
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-642s21c1
Sequence:CCGGTGGATAAATGTTAGGCATAAACTCGAGTTTATGCCTAACATTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-721s21c1
Sequence:CCGGCAACAACTTTCAAATCTATAGCTCGAGCTATAGATTTGAAAGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-886s21c1
Sequence:CCGGCTCAGAAACAAAGATCATTTCCTCGAGGAAATGATCTTTGTTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-417s21c1
Sequence:CCGGCTCAAAGGCACAATCAGTTTGCTCGAGCAAACTGATTGTGCCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-529s21c1
Sequence:CCGGCATTGCAAGGGTTCCTCATTTCTCGAGAAATGAGGAACCCTTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110790
GPR112 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 112
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-642s21c1
Sequence:CCGGTGGATAAATGTTAGGCATAAACTCGAGTTTATGCCTAACATTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-721s21c1
Sequence:CCGGCAACAACTTTCAAATCTATAGCTCGAGCTATAGATTTGAAAGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-886s21c1
Sequence:CCGGCTCAGAAACAAAGATCATTTCCTCGAGGAAATGATCTTTGTTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-417s21c1
Sequence:CCGGCTCAAAGGCACAATCAGTTTGCTCGAGCAAACTGATTGTGCCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110790.1-529s21c1
Sequence:CCGGCATTGCAAGGGTTCCTCATTTCTCGAGAAATGAGGAACCCTTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks