EMAIL THIS PAGE TO A FRIEND

GPR113

G protein-coupled receptor 113

Synonyms: PGR23 hGPCR37
Gene ID:
Mouse(381628) G protein-coupled receptor 113
Rat(298857) G protein-coupled receptor 113
domestic guinea pig(100723835) G protein-coupled receptor 113
naked mole-rat(101726575) G protein-coupled receptor 113
sheep(101110223) G protein-coupled receptor 113
Domestic Rabbit(100354593) G protein-coupled receptor 113
Horse(100071363) G protein-coupled receptor 113
cow(522893) G protein-coupled receptor 113
domestic cat(101092844) G protein-coupled receptor 113
dog(483001) G protein-coupled receptor 113
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153835 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001014394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001014394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001014394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153835 Rosetta Predictions human pricing
NM_001106712 Rosetta Predictions rat pricing
NM_001014394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092697 predicted 2690
2 SASI_Hs01_00092698 predicted 934
3 SASI_Hs02_00367522 predicted 3186
4 SASI_Hs02_00367523 predicted 897
5 SASI_Hs01_00092699 predicted 2380
6 SASI_Hs01_00092701 predicted 1819
7 SASI_Hs01_00092703 predicted 1531
8 SASI_Hs02_00367524 predicted 969
9 SASI_Hs01_00092705 predicted 1647
10 SASI_Hs02_00367525 predicted 977
11 SASI_Hs01_00092700 predicted 575
12 SASI_Hs01_00092702 predicted 2998
13 SASI_Hs01_00092704 predicted 921
14 SASI_Hs01_00092706 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221648 predicted 500
2 SASI_Rn02_00221649 predicted 2891
3 SASI_Rn02_00221650 predicted 1480
4 SASI_Rn02_00221651 predicted 1431
5 SASI_Rn02_00221652 predicted 2569
6 SASI_Rn02_00221653 predicted 1024
7 SASI_Rn02_00221654 predicted 2051
8 SASI_Rn02_00221655 predicted 2756
9 SASI_Rn02_00221656 predicted 648
10 SASI_Rn02_00221657 predicted 2778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084475 predicted 2233
2 SASI_Mm01_00084476 predicted 275
3 SASI_Mm01_00084477 predicted 351
4 SASI_Mm01_00084478 predicted 1732
5 SASI_Mm01_00084479 predicted 1962
6 SASI_Mm02_00287419 predicted 2168
7 SASI_Mm01_00084480 predicted 2205
8 SASI_Mm01_00084481 predicted 2582
9 SASI_Mm01_00084482 predicted 416
10 SASI_Mm02_00287420 predicted 2692
11 SASI_Mm01_00084483 predicted 1896
12 SASI_Mm01_00084484 predicted 1217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153835
GPR113 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 113
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153835.3-3578s21c1
Sequence:CCGGATTCAGCGATTTCTGATTATTCTCGAGAATAATCAGAAATCGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153835.3-3470s21c1
Sequence:CCGGGATATCAAAGTGCGGAATAATCTCGAGATTATTCCGCACTTTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153835.3-1539s21c1
Sequence:CCGGCAAGTTCACCCTCCGACTTACCTCGAGGTAAGTCGGAGGGTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-2925s1c1
Sequence:CCGGGCTCATTCTTACACCCATCTTCTCGAGAAGATGGGTGTAAGAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-2400s1c1
Sequence:CCGGGCGGAACAAGATCTCCTATTTCTCGAGAAATAGGAGATCTTGTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-489s1c1
Sequence:CCGGCAGACTCACAACAGAGTGTAACTCGAGTTACACTCTGTTGTGAGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-3001s1c1
Sequence:CCGGCCTCATTACATCTTCACCATTCTCGAGAATGGTGAAGATGTAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-1645s1c1
Sequence:CCGGGCCCTGAAGAATCTCCTGATTCTCGAGAATCAGGAGATTCTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153835
GPR113 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 113
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153835.3-3578s21c1
Sequence:CCGGATTCAGCGATTTCTGATTATTCTCGAGAATAATCAGAAATCGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153835.3-3470s21c1
Sequence:CCGGGATATCAAAGTGCGGAATAATCTCGAGATTATTCCGCACTTTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153835.3-1539s21c1
Sequence:CCGGCAAGTTCACCCTCCGACTTACCTCGAGGTAAGTCGGAGGGTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-2925s1c1
Sequence:CCGGGCTCATTCTTACACCCATCTTCTCGAGAAGATGGGTGTAAGAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-2400s1c1
Sequence:CCGGGCGGAACAAGATCTCCTATTTCTCGAGAAATAGGAGATCTTGTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-489s1c1
Sequence:CCGGCAGACTCACAACAGAGTGTAACTCGAGTTACACTCTGTTGTGAGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-3001s1c1
Sequence:CCGGCCTCATTACATCTTCACCATTCTCGAGAATGGTGAAGATGTAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-1645s1c1
Sequence:CCGGGCCCTGAAGAATCTCCTGATTCTCGAGAATCAGGAGATTCTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153835
GPR113 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 113
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153835.3-3578s21c1
Sequence:CCGGATTCAGCGATTTCTGATTATTCTCGAGAATAATCAGAAATCGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153835.3-3470s21c1
Sequence:CCGGGATATCAAAGTGCGGAATAATCTCGAGATTATTCCGCACTTTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153835.3-1539s21c1
Sequence:CCGGCAAGTTCACCCTCCGACTTACCTCGAGGTAAGTCGGAGGGTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-2925s1c1
Sequence:CCGGGCTCATTCTTACACCCATCTTCTCGAGAAGATGGGTGTAAGAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-2400s1c1
Sequence:CCGGGCGGAACAAGATCTCCTATTTCTCGAGAAATAGGAGATCTTGTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-489s1c1
Sequence:CCGGCAGACTCACAACAGAGTGTAACTCGAGTTACACTCTGTTGTGAGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-3001s1c1
Sequence:CCGGCCTCATTACATCTTCACCATTCTCGAGAATGGTGAAGATGTAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153835.1-1645s1c1
Sequence:CCGGGCCCTGAAGAATCTCCTGATTCTCGAGAATCAGGAGATTCTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014394
GPR113 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 113
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-1875s1c1
Sequence:CCGGGCAGAAGTTATCATGGACTATCTCGAGATAGTCCATGATAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-1540s1c1
Sequence:CCGGAGACCTTGGTTCACAGCTTAACTCGAGTTAAGCTGTGAACCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-2696s1c1
Sequence:CCGGCCTGCTTATTCTCACACCCATCTCGAGATGGGTGTGAGAATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-2685s1c1
Sequence:CCGGGTGCTTAAAGCCCTGCTTATTCTCGAGAATAAGCAGGGCTTTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-976s1c1
Sequence:CCGGCCAATACCACATACACCTGTACTCGAGTACAGGTGTATGTGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014394
GPR113 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 113
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-1875s1c1
Sequence:CCGGGCAGAAGTTATCATGGACTATCTCGAGATAGTCCATGATAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-1540s1c1
Sequence:CCGGAGACCTTGGTTCACAGCTTAACTCGAGTTAAGCTGTGAACCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-2696s1c1
Sequence:CCGGCCTGCTTATTCTCACACCCATCTCGAGATGGGTGTGAGAATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-2685s1c1
Sequence:CCGGGTGCTTAAAGCCCTGCTTATTCTCGAGAATAAGCAGGGCTTTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-976s1c1
Sequence:CCGGCCAATACCACATACACCTGTACTCGAGTACAGGTGTATGTGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014394
GPR113 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 113
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-1875s1c1
Sequence:CCGGGCAGAAGTTATCATGGACTATCTCGAGATAGTCCATGATAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-1540s1c1
Sequence:CCGGAGACCTTGGTTCACAGCTTAACTCGAGTTAAGCTGTGAACCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-2696s1c1
Sequence:CCGGCCTGCTTATTCTCACACCCATCTCGAGATGGGTGTGAGAATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-2685s1c1
Sequence:CCGGGTGCTTAAAGCCCTGCTTATTCTCGAGAATAAGCAGGGCTTTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014394.1-976s1c1
Sequence:CCGGCCAATACCACATACACCTGTACTCGAGTACAGGTGTATGTGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks