EMAIL THIS PAGE TO A FRIEND

GPR114

G protein-coupled receptor 114

144 Gene Product Result for
Synonyms: PGR27
UniProtKB ID: Q8IZF4, B3KXZ5, Q6ZMH7, Q6ZML4, Q86SL8, Q8IZ14
Gene ID:
Mouse(382045) G protein-coupled receptor 114
Rat(307645) G protein-coupled receptor 114
chicken(415634) G protein-coupled receptor 114
cow(509974) G protein-coupled receptor 114
Horse(100062576) G protein-coupled receptor 114
domestic cat(101092070) G protein-coupled receptor 114
dog(100686072) G protein-coupled receptor 114
sheep(101102583) G protein-coupled receptor 114
domestic guinea pig(100715521) G protein-coupled receptor 114
naked mole-rat(101710163) G protein-coupled receptor 114
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153837 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153837 Rosetta Predictions human pricing
NM_001107410 Rosetta Predictions rat pricing
NM_001033468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129786 predicted 903
2 SASI_Hs01_00129787 predicted 959
3 SASI_Hs01_00129788 predicted 1068
4 SASI_Hs01_00129789 predicted 706
5 SASI_Hs02_00367529 predicted 1861
6 SASI_Hs01_00129790 predicted 1760
7 SASI_Hs01_00129791 predicted 1249
8 SASI_Hs01_00129792 predicted 1560
9 SASI_Hs01_00129793 predicted 673
10 SASI_Hs01_00129794 predicted 1994
11 SASI_Hs01_00129795 predicted 1357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228545 predicted 1657
2 SASI_Rn02_00228546 predicted 928
3 SASI_Rn02_00228547 predicted 395
4 SASI_Rn02_00228548 predicted 240
5 SASI_Rn02_00228549 predicted 449
6 SASI_Rn02_00228550 predicted 218
7 SASI_Rn02_00228551 predicted 1318
8 SASI_Rn02_00228552 predicted 861
9 SASI_Rn02_00228553 predicted 1667
10 SASI_Rn02_00228554 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195269 predicted 286
2 SASI_Mm01_00195270 predicted 590
3 SASI_Mm01_00195271 predicted 454
4 SASI_Mm01_00195272 predicted 932
5 SASI_Mm01_00195273 predicted 903
6 SASI_Mm01_00195274 predicted 262
7 SASI_Mm01_00195276 predicted 506
8 SASI_Mm01_00195277 predicted 1749
9 SASI_Mm01_00195278 predicted 616
10 SASI_Mm02_00288819 predicted 1109
11 SASI_Mm01_00195275 predicted 1531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153837
GPR114 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 114
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153837.1-2409s1c1
Sequence:CCGGCCAAGTTTCAAGGACTGTCTTCTCGAGAAGACAGTCCTTGAAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-1987s1c1
Sequence:CCGGCACCATCTTAAACTCGCTCTACTCGAGTAGAGCGAGTTTAAGATGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-910s1c1
Sequence:CCGGGCGGCTCATCTGTATCTACTTCTCGAGAAGTAGATACAGATGAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-604s1c1
Sequence:CCGGCCTGAGCTACATGGAGAATATCTCGAGATATTCTCCATGTAGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-1555s1c1
Sequence:CCGGGCGTGTCTACAACATCTACATCTCGAGATGTAGATGTTGTAGACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153837.1-1566s21c1
Sequence:CCGGACATCTACATCCGCAGATATGCTCGAGCATATCTGCGGATGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153837.1-1645s21c1
Sequence:CCGGCTCTGTCAAGAGCTCGGTATACTCGAGTATACCGAGCTCTTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153837.1-960s21c1
Sequence:CCGGACAACTCATCTCTGCTGAATACTCGAGTATTCAGCAGAGATGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153837
GPR114 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 114
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153837.1-2409s1c1
Sequence:CCGGCCAAGTTTCAAGGACTGTCTTCTCGAGAAGACAGTCCTTGAAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-1987s1c1
Sequence:CCGGCACCATCTTAAACTCGCTCTACTCGAGTAGAGCGAGTTTAAGATGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-910s1c1
Sequence:CCGGGCGGCTCATCTGTATCTACTTCTCGAGAAGTAGATACAGATGAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-604s1c1
Sequence:CCGGCCTGAGCTACATGGAGAATATCTCGAGATATTCTCCATGTAGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-1555s1c1
Sequence:CCGGGCGTGTCTACAACATCTACATCTCGAGATGTAGATGTTGTAGACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153837.1-1566s21c1
Sequence:CCGGACATCTACATCCGCAGATATGCTCGAGCATATCTGCGGATGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153837.1-1645s21c1
Sequence:CCGGCTCTGTCAAGAGCTCGGTATACTCGAGTATACCGAGCTCTTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153837.1-960s21c1
Sequence:CCGGACAACTCATCTCTGCTGAATACTCGAGTATTCAGCAGAGATGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153837
GPR114 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 114
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153837.1-2409s1c1
Sequence:CCGGCCAAGTTTCAAGGACTGTCTTCTCGAGAAGACAGTCCTTGAAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-1987s1c1
Sequence:CCGGCACCATCTTAAACTCGCTCTACTCGAGTAGAGCGAGTTTAAGATGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-910s1c1
Sequence:CCGGGCGGCTCATCTGTATCTACTTCTCGAGAAGTAGATACAGATGAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-604s1c1
Sequence:CCGGCCTGAGCTACATGGAGAATATCTCGAGATATTCTCCATGTAGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153837.1-1555s1c1
Sequence:CCGGGCGTGTCTACAACATCTACATCTCGAGATGTAGATGTTGTAGACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153837.1-1566s21c1
Sequence:CCGGACATCTACATCCGCAGATATGCTCGAGCATATCTGCGGATGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153837.1-1645s21c1
Sequence:CCGGCTCTGTCAAGAGCTCGGTATACTCGAGTATACCGAGCTCTTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153837.1-960s21c1
Sequence:CCGGACAACTCATCTCTGCTGAATACTCGAGTATTCAGCAGAGATGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033468
GPR114 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 114
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-315s21c1
Sequence:CCGGTCAATCTGAGCTGCGACTTTCCTCGAGGAAAGTCGCAGCTCAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-1101s21c1
Sequence:CCGGGTGTCTACAACGCCTACATTCCTCGAGGAATGTAGGCGTTGTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-457s21c1
Sequence:CCGGTCGACTCATCTGCATCTATTTCTCGAGAAATAGATGCAGATGAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-607s21c1
Sequence:CCGGTCGGAGTCTGGAAGGGTATACCTCGAGGTATACCCTTCCAGACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033468.2-2143s21c1
Sequence:CCGGTTGAGCGATCTAGATACTATACTCGAGTATAGTATCTAGATCGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033468
GPR114 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 114
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-315s21c1
Sequence:CCGGTCAATCTGAGCTGCGACTTTCCTCGAGGAAAGTCGCAGCTCAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-1101s21c1
Sequence:CCGGGTGTCTACAACGCCTACATTCCTCGAGGAATGTAGGCGTTGTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-457s21c1
Sequence:CCGGTCGACTCATCTGCATCTATTTCTCGAGAAATAGATGCAGATGAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-607s21c1
Sequence:CCGGTCGGAGTCTGGAAGGGTATACCTCGAGGTATACCCTTCCAGACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033468.2-2143s21c1
Sequence:CCGGTTGAGCGATCTAGATACTATACTCGAGTATAGTATCTAGATCGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033468
GPR114 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 114
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-315s21c1
Sequence:CCGGTCAATCTGAGCTGCGACTTTCCTCGAGGAAAGTCGCAGCTCAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-1101s21c1
Sequence:CCGGGTGTCTACAACGCCTACATTCCTCGAGGAATGTAGGCGTTGTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-457s21c1
Sequence:CCGGTCGACTCATCTGCATCTATTTCTCGAGAAATAGATGCAGATGAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033468.2-607s21c1
Sequence:CCGGTCGGAGTCTGGAAGGGTATACCTCGAGGTATACCCTTCCAGACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033468.2-2143s21c1
Sequence:CCGGTTGAGCGATCTAGATACTATACTCGAGTATAGTATCTAGATCGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks