EMAIL THIS PAGE TO A FRIEND

GPR115

G protein-coupled receptor 115

127 Gene Product Result for
Synonyms: PGR18
Gene ID:
Mouse(78249) G protein-coupled receptor 115
Rat(501106) G protein-coupled receptor 115
domestic guinea pig(100730834) G protein-coupled receptor 115
naked mole-rat(101700639) G protein-coupled receptor 115
sheep(101121979) G protein-coupled receptor 115
Domestic Rabbit(100352009) G protein-coupled receptor 115
chicken(422063) G protein-coupled receptor 115
cow(517950) G protein-coupled receptor 115
Horse(100068555) G protein-coupled receptor 115
domestic cat(101092112) G protein-coupled receptor 115
dog(481827) G protein-coupled receptor 115
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1492 Human GPR115 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_128679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153838 Rosetta Predictions human pricing
XM_576521 Rosetta Predictions rat pricing
XR_008601 Rosetta Predictions rat pricing
XM_001476141 Rosetta Predictions mouse pricing
XM_894986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020271 predicted 2209
2 SASI_Hs01_00020272 predicted 2016
3 SASI_Hs01_00020274 predicted 637
4 SASI_Hs01_00020275 predicted 776
5 SASI_Hs01_00020276 predicted 594
6 SASI_Hs01_00020277 predicted 1342
7 SASI_Hs02_00367530 predicted 1187
8 SASI_Hs01_00020279 predicted 920
9 SASI_Hs01_00020280 predicted 1376
10 SASI_Hs02_00367531 predicted 611
11 SASI_Hs01_00020273 predicted 295
12 SASI_Hs01_00020278 predicted 2167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405489 predicted 1603
2 SASI_Rn02_00405490 predicted 824
3 SASI_Rn02_00405491 predicted 1543
4 SASI_Rn02_00405492 predicted 987
5 SASI_Rn02_00405493 predicted 1551
6 SASI_Rn02_00405494 predicted 1108
7 SASI_Rn02_00405495 predicted 950
8 SASI_Rn02_00405496 predicted 1792
9 SASI_Rn02_00405497 predicted 794
10 SASI_Rn02_00405498 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00417466 predicted 1605
2 SASI_Rn01_00155915 predicted 829
3 SASI_Rn01_00155917 predicted 1553
4 SASI_Rn01_00155918 predicted 994
5 SASI_Rn02_00417467 predicted 1546
6 SASI_Rn01_00155919 predicted 1113
7 SASI_Rn01_00155920 predicted 954
8 SASI_Rn01_00155921 predicted 1793
9 SASI_Rn02_00417468 predicted 794
10 SASI_Rn02_00417469 predicted 1743
11 SASI_Rn01_00155914 predicted 207
12 SASI_Rn01_00155916 predicted 398
13 SASI_Rn01_00155922 predicted 652
14 SASI_Rn01_00155923 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00387235 predicted 699
2 SASI_Mm02_00387236 predicted 882
3 SASI_Mm02_00387237 predicted 710
4 SASI_Mm02_00387238 predicted 1262
5 SASI_Mm02_00387239 predicted 1860
6 SASI_Mm02_00387240 predicted 1283
7 SASI_Mm02_00387241 predicted 330
8 SASI_Mm02_00387242 predicted 1687
9 SASI_Mm02_00387243 predicted 242
10 SASI_Mm02_00387244 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00429611 predicted 2205
2 SASI_Mm01_00259480 predicted 1828
3 SASI_Mm02_00429612 predicted 1966
4 SASI_Mm02_00429613 predicted 2292
5 SASI_Mm01_00259485 predicted 682
6 SASI_Mm01_00259486 predicted 2039
7 SASI_Mm01_00259487 predicted 592
8 SASI_Mm02_00429614 predicted 917
9 SASI_Mm02_00429615 predicted 1956
10 SASI_Mm02_00429616 predicted 2145
11 SASI_Mm01_00259478 predicted 975
12 SASI_Mm01_00259479 predicted 1001
13 SASI_Mm01_00259481 predicted 693
14 SASI_Mm01_00259482 predicted 1540
15 SASI_Mm01_00259483 predicted 2146
16 SASI_Mm01_00259484 predicted 1564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153838
VALIDATED
GPR115 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 115
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-2038s21c1
Sequence:CCGGTCTCAGGATGTGGTCATAATTCTCGAGAATTATGACCACATCCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-1436s21c1
Sequence:CCGGCCAAATCGATGACCGACAAAGCTCGAGCTTTGTCGGTCATCGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-330s21c1
Sequence:CCGGTAGATCCAAGATTCACCTAAACTCGAGTTTAGGTGAATCTTGGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-1189s21c1
Sequence:CCGGAGTCTTCCCAGACAGGTAAATCTCGAGATTTACCTGTCTGGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-2305s21c1
Sequence:CCGGGGCCCAACCAATGGATCTAAACTCGAGTTTAGATCCATTGGTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-989s21c1
Sequence:CCGGGGTTTCACATCAACCATAATACTCGAGTATTATGGTTGATGTGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153838.3-2536s21c1
Sequence:CCGGGCTTTAAGGAGCATGATTTATCTCGAGATAAATCATGCTCCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-1826s21c1
Sequence:CCGGATGGGTGCCCATTGATCATTGCTCGAGCAATGATCAATGGGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-1287s1c1
Sequence:CCGGCGAAGTGAAATGCCGCTGTAACTCGAGTTACAGCGGCATTTCACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-1882s1c1
Sequence:CCGGGCTGTAAATCTGATTGTGGTTCTCGAGAACCACAATCAGATTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_153838.1-936s1c1
Sequence:CCGGCCTCAATTTCTCCATGAGCATCTCGAGATGCTCATGGAGAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-505s1c1
Sequence:CCGGGCACCATCTATACCTCTGCATCTCGAGATGCAGAGGTATAGATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-2039s1c1
Sequence:CCGGCCACTCTCATAGAAGGCACTTCTCGAGAAGTGCCTTCTATGAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153838
VALIDATED
GPR115 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 115
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-2038s21c1
Sequence:CCGGTCTCAGGATGTGGTCATAATTCTCGAGAATTATGACCACATCCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-1436s21c1
Sequence:CCGGCCAAATCGATGACCGACAAAGCTCGAGCTTTGTCGGTCATCGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-330s21c1
Sequence:CCGGTAGATCCAAGATTCACCTAAACTCGAGTTTAGGTGAATCTTGGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-1189s21c1
Sequence:CCGGAGTCTTCCCAGACAGGTAAATCTCGAGATTTACCTGTCTGGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-2305s21c1
Sequence:CCGGGGCCCAACCAATGGATCTAAACTCGAGTTTAGATCCATTGGTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-989s21c1
Sequence:CCGGGGTTTCACATCAACCATAATACTCGAGTATTATGGTTGATGTGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153838.3-2536s21c1
Sequence:CCGGGCTTTAAGGAGCATGATTTATCTCGAGATAAATCATGCTCCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-1826s21c1
Sequence:CCGGATGGGTGCCCATTGATCATTGCTCGAGCAATGATCAATGGGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-1287s1c1
Sequence:CCGGCGAAGTGAAATGCCGCTGTAACTCGAGTTACAGCGGCATTTCACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-1882s1c1
Sequence:CCGGGCTGTAAATCTGATTGTGGTTCTCGAGAACCACAATCAGATTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_153838.1-936s1c1
Sequence:CCGGCCTCAATTTCTCCATGAGCATCTCGAGATGCTCATGGAGAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-505s1c1
Sequence:CCGGGCACCATCTATACCTCTGCATCTCGAGATGCAGAGGTATAGATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-2039s1c1
Sequence:CCGGCCACTCTCATAGAAGGCACTTCTCGAGAAGTGCCTTCTATGAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153838
VALIDATED
GPR115 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 115
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-2038s21c1
Sequence:CCGGTCTCAGGATGTGGTCATAATTCTCGAGAATTATGACCACATCCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-1436s21c1
Sequence:CCGGCCAAATCGATGACCGACAAAGCTCGAGCTTTGTCGGTCATCGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-330s21c1
Sequence:CCGGTAGATCCAAGATTCACCTAAACTCGAGTTTAGGTGAATCTTGGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-1189s21c1
Sequence:CCGGAGTCTTCCCAGACAGGTAAATCTCGAGATTTACCTGTCTGGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-2305s21c1
Sequence:CCGGGGCCCAACCAATGGATCTAAACTCGAGTTTAGATCCATTGGTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-989s21c1
Sequence:CCGGGGTTTCACATCAACCATAATACTCGAGTATTATGGTTGATGTGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153838.3-2536s21c1
Sequence:CCGGGCTTTAAGGAGCATGATTTATCTCGAGATAAATCATGCTCCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153838.3-1826s21c1
Sequence:CCGGATGGGTGCCCATTGATCATTGCTCGAGCAATGATCAATGGGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-1287s1c1
Sequence:CCGGCGAAGTGAAATGCCGCTGTAACTCGAGTTACAGCGGCATTTCACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-1882s1c1
Sequence:CCGGGCTGTAAATCTGATTGTGGTTCTCGAGAACCACAATCAGATTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_153838.1-936s1c1
Sequence:CCGGCCTCAATTTCTCCATGAGCATCTCGAGATGCTCATGGAGAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-505s1c1
Sequence:CCGGGCACCATCTATACCTCTGCATCTCGAGATGCAGAGGTATAGATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153838.1-2039s1c1
Sequence:CCGGCCACTCTCATAGAAGGCACTTCTCGAGAAGTGCCTTCTATGAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128679
GPR115 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 115
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-2065s1c1
Sequence:CCGGGCAGCAGAGAAGGTGTCATTACTCGAGTAATGACACCTTCTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-455s1c1
Sequence:CCGGGCATTGTTGATGCTGTGAAATCTCGAGATTTCACAGCATCAACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-817s1c1
Sequence:CCGGCCCAGGTACAATGCTACAGAACTCGAGTTCTGTAGCATTGTACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-1321s1c1
Sequence:CCGGCGGGTGGTTGTTACAGAGATACTCGAGTATCTCTGTAACAACCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-1523s1c1
Sequence:CCGGCGCTGCTCATAGTCTATGGAACTCGAGTTCCATAGACTATGAGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128679
GPR115 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 115
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-2065s1c1
Sequence:CCGGGCAGCAGAGAAGGTGTCATTACTCGAGTAATGACACCTTCTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-455s1c1
Sequence:CCGGGCATTGTTGATGCTGTGAAATCTCGAGATTTCACAGCATCAACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-817s1c1
Sequence:CCGGCCCAGGTACAATGCTACAGAACTCGAGTTCTGTAGCATTGTACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-1321s1c1
Sequence:CCGGCGGGTGGTTGTTACAGAGATACTCGAGTATCTCTGTAACAACCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-1523s1c1
Sequence:CCGGCGCTGCTCATAGTCTATGGAACTCGAGTTCCATAGACTATGAGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128679
GPR115 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 115
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-2065s1c1
Sequence:CCGGGCAGCAGAGAAGGTGTCATTACTCGAGTAATGACACCTTCTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-455s1c1
Sequence:CCGGGCATTGTTGATGCTGTGAAATCTCGAGATTTCACAGCATCAACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-817s1c1
Sequence:CCGGCCCAGGTACAATGCTACAGAACTCGAGTTCTGTAGCATTGTACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-1321s1c1
Sequence:CCGGCGGGTGGTTGTTACAGAGATACTCGAGTATCTCTGTAACAACCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128679.2-1523s1c1
Sequence:CCGGCGCTGCTCATAGTCTATGGAACTCGAGTTCCATAGACTATGAGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks