EMAIL THIS PAGE TO A FRIEND

GPR116

G protein-coupled receptor 116

111 Gene Product Result for
Synonyms: KPG_001
UniProtKB ID: Q8IZF2, O94858, Q5TF06, Q6RGN2, Q86SP0, Q9Y3Z2
Gene ID:
Mouse(224792) G protein-coupled receptor 116
Rat(245977) G protein-coupled receptor 116
chicken(422061) G protein-coupled receptor 116
chicken(101665443) G protein-coupled receptor 116
cow(532674) G protein-coupled receptor 116
Horse(100068417) G protein-coupled receptor 116
domestic cat(101101312) G protein-coupled receptor 116
dog(474926) G protein-coupled receptor 116
chicken(101750527) G protein-coupled receptor 116
sheep(101121209) G protein-coupled receptor 116
Domestic Rabbit(100348996) G protein-coupled receptor 116
domestic guinea pig(100731946) G protein-coupled receptor 116
naked mole-rat(101714612) G protein-coupled receptor 116
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098518 Rosetta Predictions human pricing
NM_015234 Rosetta Predictions human pricing
NM_139110 Rosetta Predictions rat pricing
NM_001081178 Rosetta Predictions mouse pricing
XM_001003985 Rosetta Predictions mouse pricing
XM_283438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319237 predicted 1081
2 SASI_Hs02_00319238 predicted 2625
3 SASI_Hs02_00319239 predicted 732
4 SASI_Hs02_00319240 predicted 2335
5 SASI_Hs02_00319241 predicted 2517
6 SASI_Hs02_00319242 predicted 1004
7 SASI_Hs02_00319243 predicted 1535
8 SASI_Hs02_00319244 predicted 1950
9 SASI_Hs02_00319245 predicted 1180
10 SASI_Hs02_00319246 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347360 predicted 1018
2 SASI_Hs02_00347361 predicted 2562
3 SASI_Hs01_00011267 predicted 668
4 SASI_Hs02_00347362 predicted 2277
5 SASI_Hs01_00011269 predicted 2465
6 SASI_Hs02_00347363 predicted 949
7 SASI_Hs01_00011270 predicted 1483
8 SASI_Hs02_00347364 predicted 1889
9 SASI_Hs01_00011271 predicted 1125
10 SASI_Hs01_00011272 predicted 1007
11 SASI_Hs01_00011266 predicted 3036
12 SASI_Hs01_00011268 predicted 3095
13 SASI_Hs01_00011273 predicted 1086
14 SASI_Hs01_00011274 predicted 2660
15 SASI_Hs01_00011275 predicted 2625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079150 predicted 3816
2 SASI_Rn01_00079151 predicted 3407
3 SASI_Rn01_00079152 predicted 1541
4 SASI_Rn01_00079154 predicted 2853
5 SASI_Rn01_00079155 predicted 4007
6 SASI_Rn02_00268488 predicted 750
7 SASI_Rn01_00079156 predicted 3144
8 SASI_Rn01_00079157 predicted 1660
9 SASI_Rn01_00079158 predicted 2535
10 SASI_Rn01_00079159 predicted 3321
11 SASI_Rn01_00079153 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295951 predicted 1923
2 SASI_Mm02_00295952 predicted 980
3 SASI_Mm02_00295953 predicted 2222
4 SASI_Mm02_00295954 predicted 4201
5 SASI_Mm02_00295955 predicted 1515
6 SASI_Mm02_00295956 predicted 4286
7 SASI_Mm02_00295957 predicted 3229
8 SASI_Mm02_00295958 predicted 1449
9 SASI_Mm02_00295959 predicted 1293
10 SASI_Mm02_00295960 predicted 3340
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207359 predicted 1858
2 SASI_Mm01_00207360 predicted 911
3 SASI_Mm01_00207361 predicted 2164
4 SASI_Mm01_00207362 predicted 4138
5 SASI_Mm01_00207363 predicted 4023
6 SASI_Mm01_00207364 predicted 4229
7 SASI_Mm01_00207365 predicted 3159
8 SASI_Mm01_00207366 predicted 1378
9 SASI_Mm01_00207367 predicted 1227
10 SASI_Mm01_00207368 predicted 3283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204740 predicted 1930
2 SASI_Mm01_00204741 predicted 981
3 SASI_Mm01_00204742 predicted 2231
4 SASI_Mm01_00204743 predicted 4206
5 SASI_Mm01_00204744 predicted 4098
6 SASI_Mm01_00204745 predicted 4293
7 SASI_Mm01_00204746 predicted 3229
8 SASI_Mm01_00204747 predicted 1455
9 SASI_Mm01_00204748 predicted 1293
10 SASI_Mm01_00204749 predicted 3351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015234
GPR116 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 116
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-2381s1c1
Sequence:CCGGGCCATTATTAACATCCTTGATCTCGAGATCAAGGATGTTAATAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-3088s1c1
Sequence:CCGGCCTGGGAATACTCCTGGATATCTCGAGATATCCAGGAGTATTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-1212s1c1
Sequence:CCGGGCGACAACAATCCTGTATCTTCTCGAGAAGATACAGGATTGTTGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-243s1c1
Sequence:CCGGCGGCTGAAGAATACACTGTTACTCGAGTAACAGTGTATTCTTCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015234.3-4368s1c1
Sequence:CCGGGCCCAACTTCTCTGTCTATATCTCGAGATATAGACAGAGAAGTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015234.4-1718s21c1
Sequence:CCGGAGTAACTATGATGAGGTTTATCTCGAGATAAACCTCATCATAGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015234.4-4488s21c1
Sequence:CCGGACCACATGTGTATAGTATTTACTCGAGTAAATACTATACACATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015234.4-843s21c1
Sequence:CCGGTCCGGAAGGGTTACGGAATTTCTCGAGAAATTCCGTAACCCTTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015234
GPR116 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 116
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-2381s1c1
Sequence:CCGGGCCATTATTAACATCCTTGATCTCGAGATCAAGGATGTTAATAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-3088s1c1
Sequence:CCGGCCTGGGAATACTCCTGGATATCTCGAGATATCCAGGAGTATTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-1212s1c1
Sequence:CCGGGCGACAACAATCCTGTATCTTCTCGAGAAGATACAGGATTGTTGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-243s1c1
Sequence:CCGGCGGCTGAAGAATACACTGTTACTCGAGTAACAGTGTATTCTTCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015234.3-4368s1c1
Sequence:CCGGGCCCAACTTCTCTGTCTATATCTCGAGATATAGACAGAGAAGTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015234.4-1718s21c1
Sequence:CCGGAGTAACTATGATGAGGTTTATCTCGAGATAAACCTCATCATAGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015234.4-4488s21c1
Sequence:CCGGACCACATGTGTATAGTATTTACTCGAGTAAATACTATACACATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015234.4-843s21c1
Sequence:CCGGTCCGGAAGGGTTACGGAATTTCTCGAGAAATTCCGTAACCCTTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015234
GPR116 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 116
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-2381s1c1
Sequence:CCGGGCCATTATTAACATCCTTGATCTCGAGATCAAGGATGTTAATAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-3088s1c1
Sequence:CCGGCCTGGGAATACTCCTGGATATCTCGAGATATCCAGGAGTATTCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-1212s1c1
Sequence:CCGGGCGACAACAATCCTGTATCTTCTCGAGAAGATACAGGATTGTTGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015234.3-243s1c1
Sequence:CCGGCGGCTGAAGAATACACTGTTACTCGAGTAACAGTGTATTCTTCAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015234.3-4368s1c1
Sequence:CCGGGCCCAACTTCTCTGTCTATATCTCGAGATATAGACAGAGAAGTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015234.4-1718s21c1
Sequence:CCGGAGTAACTATGATGAGGTTTATCTCGAGATAAACCTCATCATAGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015234.4-4488s21c1
Sequence:CCGGACCACATGTGTATAGTATTTACTCGAGTAAATACTATACACATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015234.4-843s21c1
Sequence:CCGGTCCGGAAGGGTTACGGAATTTCTCGAGAAATTCCGTAACCCTTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081178
GPR116 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 116
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1309s21c1
Sequence:GTACCGGGCAATGTGACATTGGATATTTCTCGAGAAATATCCAATGTCACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081178.1-6428s21c1
Sequence:CCGGCACACGCCTATCCCAATTTAACTCGAGTTAAATTGGGATAGGCGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1772s21c1
Sequence:CCGGGAACACCTCAGCTGGTATTAACTCGAGTTAATACCAGCTGAGGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1068s21c1
Sequence:CCGGCCGAGCAATGAGACGAAATTCCTCGAGGAATTTCGTCTCATTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-4005s21c1
Sequence:CCGGGCTGTGTTCCACATCATATTTCTCGAGAAATATGATGTGGAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1196s21c1
Sequence:CCGGCATCCAGAACAGCGACAAATACTCGAGTATTTGTCGCTGTTCTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1253s21c1
Sequence:CCGGGATCACCCGCCTTACCATTTACTCGAGTAAATGGTAAGGCGGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1681s21c1
Sequence:CCGGCAATAACCCGGGACCCAATTTCTCGAGAAATTGGGTCCCGGGTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081178.1-5892s21c1
Sequence:CCGGTGGTTTACCCTTCGGAATATACTCGAGTATATTCCGAAGGGTAAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081178
GPR116 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 116
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1309s21c1
Sequence:GTACCGGGCAATGTGACATTGGATATTTCTCGAGAAATATCCAATGTCACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081178.1-6428s21c1
Sequence:CCGGCACACGCCTATCCCAATTTAACTCGAGTTAAATTGGGATAGGCGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1772s21c1
Sequence:CCGGGAACACCTCAGCTGGTATTAACTCGAGTTAATACCAGCTGAGGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1068s21c1
Sequence:CCGGCCGAGCAATGAGACGAAATTCCTCGAGGAATTTCGTCTCATTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-4005s21c1
Sequence:CCGGGCTGTGTTCCACATCATATTTCTCGAGAAATATGATGTGGAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1196s21c1
Sequence:CCGGCATCCAGAACAGCGACAAATACTCGAGTATTTGTCGCTGTTCTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1253s21c1
Sequence:CCGGGATCACCCGCCTTACCATTTACTCGAGTAAATGGTAAGGCGGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1681s21c1
Sequence:CCGGCAATAACCCGGGACCCAATTTCTCGAGAAATTGGGTCCCGGGTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081178.1-5892s21c1
Sequence:CCGGTGGTTTACCCTTCGGAATATACTCGAGTATATTCCGAAGGGTAAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081178
GPR116 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 116
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1309s21c1
Sequence:GTACCGGGCAATGTGACATTGGATATTTCTCGAGAAATATCCAATGTCACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081178.1-6428s21c1
Sequence:CCGGCACACGCCTATCCCAATTTAACTCGAGTTAAATTGGGATAGGCGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1772s21c1
Sequence:CCGGGAACACCTCAGCTGGTATTAACTCGAGTTAATACCAGCTGAGGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1068s21c1
Sequence:CCGGCCGAGCAATGAGACGAAATTCCTCGAGGAATTTCGTCTCATTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-4005s21c1
Sequence:CCGGGCTGTGTTCCACATCATATTTCTCGAGAAATATGATGTGGAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1196s21c1
Sequence:CCGGCATCCAGAACAGCGACAAATACTCGAGTATTTGTCGCTGTTCTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1253s21c1
Sequence:CCGGGATCACCCGCCTTACCATTTACTCGAGTAAATGGTAAGGCGGGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081178.1-1681s21c1
Sequence:CCGGCAATAACCCGGGACCCAATTTCTCGAGAAATTGGGTCCCGGGTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081178.1-5892s21c1
Sequence:CCGGTGGTTTACCCTTCGGAATATACTCGAGTATATTCCGAAGGGTAAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)