EMAIL THIS PAGE TO A FRIEND

GPR119

G protein-coupled receptor 119

53 Gene Product Result for
Synonyms: GPCR2
UniProtKB ID: Q8TDV5, Q495H7, Q4VBN3
Gene ID:
Human(139760) Summary: This gene encodes a member of the rhodopsin subfamily of G-protein-coupled receptors that is expressed in the pancreas and gastrointestinal tract. The encoded protein is activated by lipid amides including lysophosphatidylcholine and oleoylethanolamide and may be involved in glucose homeostasis. This protein is a potential drug target in the treatment of type 2 diabetes.[provided by RefSeq, Jan 2010]
Mouse(236781) G-protein coupled receptor 119
Rat(302813) G protein-coupled receptor 119
chicken(428690) G protein-coupled receptor 119
domestic cat(101083248) G protein-coupled receptor 119
cow(524232) G protein-coupled receptor 119
dog(492134) G protein-coupled receptor 119
domestic guinea pig(100733745) G protein-coupled receptor 119
naked mole-rat(101702708) G protein-coupled receptor 119
sheep(101122415) G protein-coupled receptor 119
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500477 Anti-GPR119 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4500469 Anti-GPR119 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_066873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_066873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_066873 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178471 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139371 MISSION® esiRNA esiRNA human GPR119 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178471 Rosetta Predictions human pricing
NM_181770 Rosetta Predictions rat pricing
NM_181751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175476 predicted 282
2 SASI_Hs01_00175477 predicted 655
3 SASI_Hs02_00369723 predicted 479
4 SASI_Hs01_00175478 predicted 529
5 SASI_Hs01_00175479 predicted 372
6 SASI_Hs01_00175480 predicted 195
7 SASI_Hs01_00175481 predicted 672
8 SASI_Hs01_00175482 predicted 747
9 SASI_Hs01_00175484 predicted 307
10 SASI_Hs01_00175485 predicted 271
11 SASI_Hs01_00175483 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052310 predicted 1046
2 SASI_Rn02_00269803 predicted 951
3 SASI_Rn01_00052311 predicted 665
4 SASI_Rn01_00052312 predicted 879
5 SASI_Rn01_00052314 predicted 1077
6 SASI_Rn01_00052315 predicted 331
7 SASI_Rn01_00052316 predicted 748
8 SASI_Rn01_00052317 predicted 650
9 SASI_Rn01_00052318 predicted 291
10 SASI_Rn01_00052313 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349913 predicted 388
2 SASI_Mm02_00349914 predicted 1248
3 SASI_Mm01_00116538 predicted 702
4 SASI_Mm02_00349915 predicted 979
5 SASI_Mm01_00116540 predicted 966
6 SASI_Mm01_00116542 predicted 509
7 SASI_Mm02_00349916 predicted 370
8 SASI_Mm02_00349917 predicted 365
9 SASI_Mm02_00349918 predicted 873
10 SASI_Mm02_00349919 predicted 548
11 SASI_Mm01_00116537 predicted 203
12 SASI_Mm01_00116539 predicted 668
13 SASI_Mm01_00116541 predicted 620
14 SASI_Mm01_00116543 predicted 525
15 SASI_Mm01_00116544 predicted 241
16 SASI_Mm01_00116545 predicted 232
17 SASI_Mm01_00116546 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_066873
GPR119 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 119
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-718s1c1
Sequence:CCGGCCCTTCCTTATCACTGGCATTCTCGAGAATGCCAGTGATAAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-44s1c1
Sequence:CCGGCCTCCCTCATCATTGCTACTACTCGAGTAGTAGCAATGATGAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-462s1c1
Sequence:CCGGGTGCAGCTTCTTTGCTGTATTCTCGAGAATACAGCAAAGAAGCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-534s1c1
Sequence:CCGGGCTCCTCTTTGTCTTCTTCTACTCGAGTAGAAGAAGACAAAGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-87s1c1
Sequence:CCGGGCTGCTGTTGATCCACAAGAACTCGAGTTCTTGTGGATCAACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_066873
GPR119 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 119
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-718s1c1
Sequence:CCGGCCCTTCCTTATCACTGGCATTCTCGAGAATGCCAGTGATAAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-44s1c1
Sequence:CCGGCCTCCCTCATCATTGCTACTACTCGAGTAGTAGCAATGATGAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-462s1c1
Sequence:CCGGGTGCAGCTTCTTTGCTGTATTCTCGAGAATACAGCAAAGAAGCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-534s1c1
Sequence:CCGGGCTCCTCTTTGTCTTCTTCTACTCGAGTAGAAGAAGACAAAGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-87s1c1
Sequence:CCGGGCTGCTGTTGATCCACAAGAACTCGAGTTCTTGTGGATCAACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_066873
GPR119 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 119
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-718s1c1
Sequence:CCGGCCCTTCCTTATCACTGGCATTCTCGAGAATGCCAGTGATAAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-44s1c1
Sequence:CCGGCCTCCCTCATCATTGCTACTACTCGAGTAGTAGCAATGATGAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-462s1c1
Sequence:CCGGGTGCAGCTTCTTTGCTGTATTCTCGAGAATACAGCAAAGAAGCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-534s1c1
Sequence:CCGGGCTCCTCTTTGTCTTCTTCTACTCGAGTAGAAGAAGACAAAGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066873.1-87s1c1
Sequence:CCGGGCTGCTGTTGATCCACAAGAACTCGAGTTCTTGTGGATCAACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181751
GPR119 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 119
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-475s1c1
Sequence:CCGGGCTGTGTTTCACCCAAGGTTTCTCGAGAAACCTTGGGTGAAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-166s1c1
Sequence:CCGGGTGGCTATTTCTGGTCTAGTTCTCGAGAACTAGACCAGAAATAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-334s1c1
Sequence:CCGGCGTTACTTCCAGATCATGAATCTCGAGATTCATGATCTGGAAGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-764s1c1
Sequence:CCGGGCCTTTACCAAGTGCTGGAAACTCGAGTTTCCAGCACTTGGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-58s1c1
Sequence:CCGGGCTGTTAATGCACTGGTAGTTCTCGAGAACTACCAGTGCATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181751
GPR119 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 119
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-475s1c1
Sequence:CCGGGCTGTGTTTCACCCAAGGTTTCTCGAGAAACCTTGGGTGAAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-166s1c1
Sequence:CCGGGTGGCTATTTCTGGTCTAGTTCTCGAGAACTAGACCAGAAATAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-334s1c1
Sequence:CCGGCGTTACTTCCAGATCATGAATCTCGAGATTCATGATCTGGAAGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-764s1c1
Sequence:CCGGGCCTTTACCAAGTGCTGGAAACTCGAGTTTCCAGCACTTGGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-58s1c1
Sequence:CCGGGCTGTTAATGCACTGGTAGTTCTCGAGAACTACCAGTGCATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181751
GPR119 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 119
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-475s1c1
Sequence:CCGGGCTGTGTTTCACCCAAGGTTTCTCGAGAAACCTTGGGTGAAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-166s1c1
Sequence:CCGGGTGGCTATTTCTGGTCTAGTTCTCGAGAACTAGACCAGAAATAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-334s1c1
Sequence:CCGGCGTTACTTCCAGATCATGAATCTCGAGATTCATGATCTGGAAGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-764s1c1
Sequence:CCGGGCCTTTACCAAGTGCTGGAAACTCGAGTTTCCAGCACTTGGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181751.1-58s1c1
Sequence:CCGGGCTGTTAATGCACTGGTAGTTCTCGAGAACTACCAGTGCATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178471
GPR119 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 119
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-672s1c1
Sequence:CCGGCCGTACTGTGTCTGTTCTCATCTCGAGATGAGAACAGACACAGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-330s1c1
Sequence:CCGGCTTCCGCTACTTGAAGATCATCTCGAGATGATCTTCAAGTAGCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-387s1c1
Sequence:CCGGGTGGTTAGTGTCTTACCTCATCTCGAGATGAGGTAAGACACTAACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-88s1c1
Sequence:CCGGCTGCTGTTGATCCACAAGAATCTCGAGATTCTTGTGGATCAACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-822s1c1
Sequence:CCGGCAACCCACTCATCTATGCCTACTCGAGTAGGCATAGATGAGTGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178471
GPR119 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 119
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-672s1c1
Sequence:CCGGCCGTACTGTGTCTGTTCTCATCTCGAGATGAGAACAGACACAGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-330s1c1
Sequence:CCGGCTTCCGCTACTTGAAGATCATCTCGAGATGATCTTCAAGTAGCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-387s1c1
Sequence:CCGGGTGGTTAGTGTCTTACCTCATCTCGAGATGAGGTAAGACACTAACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-88s1c1
Sequence:CCGGCTGCTGTTGATCCACAAGAATCTCGAGATTCTTGTGGATCAACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-822s1c1
Sequence:CCGGCAACCCACTCATCTATGCCTACTCGAGTAGGCATAGATGAGTGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178471
GPR119 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 119
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-672s1c1
Sequence:CCGGCCGTACTGTGTCTGTTCTCATCTCGAGATGAGAACAGACACAGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-330s1c1
Sequence:CCGGCTTCCGCTACTTGAAGATCATCTCGAGATGATCTTCAAGTAGCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-387s1c1
Sequence:CCGGGTGGTTAGTGTCTTACCTCATCTCGAGATGAGGTAAGACACTAACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-88s1c1
Sequence:CCGGCTGCTGTTGATCCACAAGAATCTCGAGATTCTTGTGGATCAACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178471.1-822s1c1
Sequence:CCGGCAACCCACTCATCTATGCCTACTCGAGTAGGCATAGATGAGTGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks